FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629623_at:

>probe:Drosophila_2:1629623_at:422:295; Interrogation_Position=365; Antisense; CGACGCATGTCTGTTCTGAACAAGT
>probe:Drosophila_2:1629623_at:687:385; Interrogation_Position=400; Antisense; GAACATCACTGATATTCTGGCCACC
>probe:Drosophila_2:1629623_at:91:95; Interrogation_Position=430; Antisense; AGTTGCCGATTCCATCGTGGGACAC
>probe:Drosophila_2:1629623_at:296:433; Interrogation_Position=456; Antisense; GAGTGCAGATTTCCTATGTCAAGAT
>probe:Drosophila_2:1629623_at:137:61; Interrogation_Position=471; Antisense; ATGTCAAGATCACCAGCGACTTCTC
>probe:Drosophila_2:1629623_at:538:713; Interrogation_Position=491; Antisense; TTCTCCCGCATCAATGTCTATTGGA
>probe:Drosophila_2:1629623_at:469:121; Interrogation_Position=569; Antisense; AGCGGCAAACTGCAGCACGAGCTAT
>probe:Drosophila_2:1629623_at:160:45; Interrogation_Position=592; Antisense; ATCGCAGCTCCATCTGATGGGCGAA
>probe:Drosophila_2:1629623_at:186:183; Interrogation_Position=644; Antisense; AAAACGAGCACTGGTCTCCATCAGG
>probe:Drosophila_2:1629623_at:205:269; Interrogation_Position=662; Antisense; CATCAGGTCCACGAGGTTCTGTCCA
>probe:Drosophila_2:1629623_at:340:273; Interrogation_Position=691; Antisense; CGATCTTCAGCACAGTTACTCTAGT
>probe:Drosophila_2:1629623_at:463:155; Interrogation_Position=745; Antisense; ACAGAGTTGTCAGACGGCTGCGGAT
>probe:Drosophila_2:1629623_at:591:137; Interrogation_Position=790; Antisense; ACAGGATTTCCTCAGTTTTAACCAT
>probe:Drosophila_2:1629623_at:118:13; Interrogation_Position=833; Antisense; ATTCTCGGCAAGATGCGCAAGTCCA

Paste this into a BLAST search page for me
CGACGCATGTCTGTTCTGAACAAGTGAACATCACTGATATTCTGGCCACCAGTTGCCGATTCCATCGTGGGACACGAGTGCAGATTTCCTATGTCAAGATATGTCAAGATCACCAGCGACTTCTCTTCTCCCGCATCAATGTCTATTGGAAGCGGCAAACTGCAGCACGAGCTATATCGCAGCTCCATCTGATGGGCGAAAAAACGAGCACTGGTCTCCATCAGGCATCAGGTCCACGAGGTTCTGTCCACGATCTTCAGCACAGTTACTCTAGTACAGAGTTGTCAGACGGCTGCGGATACAGGATTTCCTCAGTTTTAACCATATTCTCGGCAAGATGCGCAAGTCCA

Full Affymetrix probeset data:

Annotations for 1629623_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720