FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629627_at:

>probe:Drosophila_2:1629627_at:578:99; Interrogation_Position=105; Antisense; AGATGGCTTGCTTCAAGGTGACTGC
>probe:Drosophila_2:1629627_at:357:223; Interrogation_Position=119; Antisense; AAGGTGACTGCGACTCTAATGGCCG
>probe:Drosophila_2:1629627_at:323:603; Interrogation_Position=261; Antisense; TGTTACCCCATCCATGTTCGAGTGG
>probe:Drosophila_2:1629627_at:297:671; Interrogation_Position=300; Antisense; TACGATGTTTTTGCCCTACAACCCG
>probe:Drosophila_2:1629627_at:238:253; Interrogation_Position=318; Antisense; CAACCCGGCGAGGAAGTCAGTGATC
>probe:Drosophila_2:1629627_at:269:605; Interrogation_Position=338; Antisense; TGATCCAAACACTTGCGGCGTGCAG
>probe:Drosophila_2:1629627_at:582:509; Interrogation_Position=357; Antisense; GTGCAGGTTTGCATGAACTCCGAAG
>probe:Drosophila_2:1629627_at:437:557; Interrogation_Position=381; Antisense; GGACTTACTCATGTCTACTAGCTGT
>probe:Drosophila_2:1629627_at:727:57; Interrogation_Position=40; Antisense; ATGATGCTGCTGCTACTGAATCTTT
>probe:Drosophila_2:1629627_at:111:33; Interrogation_Position=440; Antisense; ATAAGGCCATGGACTTGTTGCTAAA
>probe:Drosophila_2:1629627_at:486:583; Interrogation_Position=481; Antisense; TGGACTTGTGCCACCAGTAGGGACT
>probe:Drosophila_2:1629627_at:685:49; Interrogation_Position=509; Antisense; ATGAAGACCAGTCCTTTCCTTCTTA
>probe:Drosophila_2:1629627_at:5:341; Interrogation_Position=51; Antisense; GCTACTGAATCTTTTGTGCCACGGA
>probe:Drosophila_2:1629627_at:583:703; Interrogation_Position=531; Antisense; TTATCCTTATCCTCCCGAAATACGT

Paste this into a BLAST search page for me
AGATGGCTTGCTTCAAGGTGACTGCAAGGTGACTGCGACTCTAATGGCCGTGTTACCCCATCCATGTTCGAGTGGTACGATGTTTTTGCCCTACAACCCGCAACCCGGCGAGGAAGTCAGTGATCTGATCCAAACACTTGCGGCGTGCAGGTGCAGGTTTGCATGAACTCCGAAGGGACTTACTCATGTCTACTAGCTGTATGATGCTGCTGCTACTGAATCTTTATAAGGCCATGGACTTGTTGCTAAATGGACTTGTGCCACCAGTAGGGACTATGAAGACCAGTCCTTTCCTTCTTAGCTACTGAATCTTTTGTGCCACGGATTATCCTTATCCTCCCGAAATACGT

Full Affymetrix probeset data:

Annotations for 1629627_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720