Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629629_at:

>probe:Drosophila_2:1629629_at:458:393; Interrogation_Position=1459; Antisense; GAAAGAAAGGCTGGCCTCACTCGCA
>probe:Drosophila_2:1629629_at:565:565; Interrogation_Position=1534; Antisense; GGCACCGACTATGGGATTGAGCACT
>probe:Drosophila_2:1629629_at:84:417; Interrogation_Position=1552; Antisense; GAGCACTCGAAGATCTCGTACTATT
>probe:Drosophila_2:1629629_at:310:293; Interrogation_Position=1568; Antisense; CGTACTATTTGACGCTGCCCAGGGA
>probe:Drosophila_2:1629629_at:262:683; Interrogation_Position=1606; Antisense; TATCGCGACGACATCACAATCACTG
>probe:Drosophila_2:1629629_at:595:141; Interrogation_Position=1627; Antisense; ACTGTCATCTACTTTAACTCGGAGC
>probe:Drosophila_2:1629629_at:69:553; Interrogation_Position=1647; Antisense; GGAGCACATTGCCAAGCTGCACAGC
>probe:Drosophila_2:1629629_at:411:589; Interrogation_Position=1676; Antisense; TGGATCAAACGGAGGTCACTGCGCC
>probe:Drosophila_2:1629629_at:670:317; Interrogation_Position=1698; Antisense; GCCGGTAGCATGATCTCTGCGAGAG
>probe:Drosophila_2:1629629_at:540:675; Interrogation_Position=1735; Antisense; TATTTAACGAGCCTAACCTTCAGCC
>probe:Drosophila_2:1629629_at:227:317; Interrogation_Position=1757; Antisense; GCCGAACTAGCCTAAGTGTTGCGTT
>probe:Drosophila_2:1629629_at:581:477; Interrogation_Position=1779; Antisense; GTTTAAGTTTGTTTCATCCGCCATC
>probe:Drosophila_2:1629629_at:636:639; Interrogation_Position=1809; Antisense; TCGGACGACTGCTGCGCCAAATAAA
>probe:Drosophila_2:1629629_at:344:449; Interrogation_Position=1894; Antisense; GATCGGTCGTCTCATTTGTTAATAA

Paste this into a BLAST search page for me
GAAAGAAAGGCTGGCCTCACTCGCAGGCACCGACTATGGGATTGAGCACTGAGCACTCGAAGATCTCGTACTATTCGTACTATTTGACGCTGCCCAGGGATATCGCGACGACATCACAATCACTGACTGTCATCTACTTTAACTCGGAGCGGAGCACATTGCCAAGCTGCACAGCTGGATCAAACGGAGGTCACTGCGCCGCCGGTAGCATGATCTCTGCGAGAGTATTTAACGAGCCTAACCTTCAGCCGCCGAACTAGCCTAAGTGTTGCGTTGTTTAAGTTTGTTTCATCCGCCATCTCGGACGACTGCTGCGCCAAATAAAGATCGGTCGTCTCATTTGTTAATAA

Full Affymetrix probeset data:

Annotations for 1629629_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime