FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629631_at:

>probe:Drosophila_2:1629631_at:589:351; Interrogation_Position=109; Antisense; GCAGCAGCCCACTCCGATAAAGAAG
>probe:Drosophila_2:1629631_at:281:719; Interrogation_Position=171; Antisense; TTCCTGTTCCTGTTTATCCCAAAGA
>probe:Drosophila_2:1629631_at:665:377; Interrogation_Position=320; Antisense; GAAGCTTTACGGTGCCTGCGGGAAT
>probe:Drosophila_2:1629631_at:561:563; Interrogation_Position=340; Antisense; GGAATGGGCCTGTCAGTACGTCATC
>probe:Drosophila_2:1629631_at:79:649; Interrogation_Position=352; Antisense; TCAGTACGTCATCCGGCTGGATCTG
>probe:Drosophila_2:1629631_at:311:623; Interrogation_Position=375; Antisense; TGCGCTGCCTGCTCACTTTAAATGG
>probe:Drosophila_2:1629631_at:361:169; Interrogation_Position=394; Antisense; AAATGGCAACCCATTGCTGGGCAAT
>probe:Drosophila_2:1629631_at:154:721; Interrogation_Position=407; Antisense; TTGCTGGGCAATCTCATTTCCATAC
>probe:Drosophila_2:1629631_at:487:705; Interrogation_Position=44; Antisense; TTAGTTATATCCCTAGCTGTGCTAG
>probe:Drosophila_2:1629631_at:104:563; Interrogation_Position=493; Antisense; TGGCAAATAGAGGACCCCGTTCGGT
>probe:Drosophila_2:1629631_at:416:717; Interrogation_Position=512; Antisense; TTCGGTGGCGAAAATGTGCTCACAT
>probe:Drosophila_2:1629631_at:519:119; Interrogation_Position=58; Antisense; AGCTGTGCTAGGACTAATATCCCTG
>probe:Drosophila_2:1629631_at:328:243; Interrogation_Position=73; Antisense; AATATCCCTGGCCTTGGGTCACAAT
>probe:Drosophila_2:1629631_at:419:531; Interrogation_Position=88; Antisense; GGGTCACAATAATCCCTGGGAGCAG

Paste this into a BLAST search page for me
GCAGCAGCCCACTCCGATAAAGAAGTTCCTGTTCCTGTTTATCCCAAAGAGAAGCTTTACGGTGCCTGCGGGAATGGAATGGGCCTGTCAGTACGTCATCTCAGTACGTCATCCGGCTGGATCTGTGCGCTGCCTGCTCACTTTAAATGGAAATGGCAACCCATTGCTGGGCAATTTGCTGGGCAATCTCATTTCCATACTTAGTTATATCCCTAGCTGTGCTAGTGGCAAATAGAGGACCCCGTTCGGTTTCGGTGGCGAAAATGTGCTCACATAGCTGTGCTAGGACTAATATCCCTGAATATCCCTGGCCTTGGGTCACAATGGGTCACAATAATCCCTGGGAGCAG

Full Affymetrix probeset data:

Annotations for 1629631_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720