FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629632_at:

>probe:Drosophila_2:1629632_at:584:1; Interrogation_Position=2229; Antisense; ACGAAACTATTGCTACCGAACTGGT
>probe:Drosophila_2:1629632_at:303:509; Interrogation_Position=2328; Antisense; GTGACTTCAACCGAACCGATCAGGT
>probe:Drosophila_2:1629632_at:3:203; Interrogation_Position=2341; Antisense; AACCGATCAGGTTCTGGGCAGCGAT
>probe:Drosophila_2:1629632_at:1:287; Interrogation_Position=2354; Antisense; CTGGGCAGCGATTACTTGAGCAAAT
>probe:Drosophila_2:1629632_at:154:517; Interrogation_Position=2388; Antisense; GTGGACCCGGTGGACTAACCAGTAG
>probe:Drosophila_2:1629632_at:617:439; Interrogation_Position=2441; Antisense; GATGGCGACGGCAGCTTTGACTATG
>probe:Drosophila_2:1629632_at:183:725; Interrogation_Position=2457; Antisense; TTGACTATGCGGCAGTGGCTTCTTC
>probe:Drosophila_2:1629632_at:444:671; Interrogation_Position=2496; Antisense; TACCGCGATCCCTGTCGGAGGAGAT
>probe:Drosophila_2:1629632_at:369:413; Interrogation_Position=2525; Antisense; GACCGTTTCGGTGTGAGCACTCAGG
>probe:Drosophila_2:1629632_at:98:99; Interrogation_Position=2590; Antisense; AGATGGTCGAATTGTCGGCCCACCA
>probe:Drosophila_2:1629632_at:425:557; Interrogation_Position=2621; Antisense; GGACTCTTCGACGATGTCTAGACTT
>probe:Drosophila_2:1629632_at:586:91; Interrogation_Position=2682; Antisense; AGTATCTCAATATTTCGCTCGCGCT
>probe:Drosophila_2:1629632_at:610:341; Interrogation_Position=2704; Antisense; GCTTAAGTATTTCCCGATGCCACTG
>probe:Drosophila_2:1629632_at:260:621; Interrogation_Position=2736; Antisense; TGCTGTTCCTTTACACCCATGTAGA

Paste this into a BLAST search page for me
ACGAAACTATTGCTACCGAACTGGTGTGACTTCAACCGAACCGATCAGGTAACCGATCAGGTTCTGGGCAGCGATCTGGGCAGCGATTACTTGAGCAAATGTGGACCCGGTGGACTAACCAGTAGGATGGCGACGGCAGCTTTGACTATGTTGACTATGCGGCAGTGGCTTCTTCTACCGCGATCCCTGTCGGAGGAGATGACCGTTTCGGTGTGAGCACTCAGGAGATGGTCGAATTGTCGGCCCACCAGGACTCTTCGACGATGTCTAGACTTAGTATCTCAATATTTCGCTCGCGCTGCTTAAGTATTTCCCGATGCCACTGTGCTGTTCCTTTACACCCATGTAGA

Full Affymetrix probeset data:

Annotations for 1629632_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720