FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629633_at:

>probe:Drosophila_2:1629633_at:509:397; Interrogation_Position=1007; Antisense; GACACAGTCGTGACCGATTTCGAAG
>probe:Drosophila_2:1629633_at:236:457; Interrogation_Position=1046; Antisense; GATAGCTGTCTTCATTATCGACCAG
>probe:Drosophila_2:1629633_at:538:415; Interrogation_Position=1071; Antisense; GAGCCTTCTCTATCAACGGCGAGGA
>probe:Drosophila_2:1629633_at:566:455; Interrogation_Position=1094; Antisense; GATACTATAGTTCCCCTAGATTCCA
>probe:Drosophila_2:1629633_at:284:399; Interrogation_Position=1131; Antisense; GACAGCGAGTGGGTCTTAGCTCCAA
>probe:Drosophila_2:1629633_at:654:265; Interrogation_Position=651; Antisense; CAGATGACTTTGACACGGCGCACAA
>probe:Drosophila_2:1629633_at:263:197; Interrogation_Position=688; Antisense; AACTGGCATCGATACCTTGGAGCTG
>probe:Drosophila_2:1629633_at:664:551; Interrogation_Position=706; Antisense; GGAGCTGCACACTTGTTTGAGGTTT
>probe:Drosophila_2:1629633_at:439:305; Interrogation_Position=755; Antisense; GCCTATTTGACGGTTACGGCCAAGT
>probe:Drosophila_2:1629633_at:435:87; Interrogation_Position=777; Antisense; AGTCTGGAGGATGCTACACTGCCGT
>probe:Drosophila_2:1629633_at:86:237; Interrogation_Position=830; Antisense; AATCTGGAAATATACCCGCTCGGCG
>probe:Drosophila_2:1629633_at:720:301; Interrogation_Position=869; Antisense; CCCGGAACGATCCTGCATGAGTTTA
>probe:Drosophila_2:1629633_at:256:477; Interrogation_Position=889; Antisense; GTTTATGCACGCCTTGGGATTCTAT
>probe:Drosophila_2:1629633_at:253:543; Interrogation_Position=905; Antisense; GGATTCTATCACCAACAGAGCTCGT

Paste this into a BLAST search page for me
GACACAGTCGTGACCGATTTCGAAGGATAGCTGTCTTCATTATCGACCAGGAGCCTTCTCTATCAACGGCGAGGAGATACTATAGTTCCCCTAGATTCCAGACAGCGAGTGGGTCTTAGCTCCAACAGATGACTTTGACACGGCGCACAAAACTGGCATCGATACCTTGGAGCTGGGAGCTGCACACTTGTTTGAGGTTTGCCTATTTGACGGTTACGGCCAAGTAGTCTGGAGGATGCTACACTGCCGTAATCTGGAAATATACCCGCTCGGCGCCCGGAACGATCCTGCATGAGTTTAGTTTATGCACGCCTTGGGATTCTATGGATTCTATCACCAACAGAGCTCGT

Full Affymetrix probeset data:

Annotations for 1629633_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720