Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629634_at:

>probe:Drosophila_2:1629634_at:174:451; Interrogation_Position=4294; Antisense; GATCGCGATCTCAAGCGCGGCAAAC
>probe:Drosophila_2:1629634_at:274:639; Interrogation_Position=4302; Antisense; TCTCAAGCGCGGCAAACCTTTGTAT
>probe:Drosophila_2:1629634_at:262:205; Interrogation_Position=4306; Antisense; AAGCGCGGCAAACCTTTGTATTTGA
>probe:Drosophila_2:1629634_at:717:329; Interrogation_Position=4310; Antisense; GCGGCAAACCTTTGTATTTGAGCAA
>probe:Drosophila_2:1629634_at:417:481; Interrogation_Position=4323; Antisense; GTATTTGAGCAAAGACCGCTTCAAT
>probe:Drosophila_2:1629634_at:628:171; Interrogation_Position=4333; Antisense; AAAGACCGCTTCAATCTCCTGGAGT
>probe:Drosophila_2:1629634_at:218:239; Interrogation_Position=4345; Antisense; AATCTCCTGGAGTCGCAGTGGCTGT
>probe:Drosophila_2:1629634_at:148:589; Interrogation_Position=4352; Antisense; TGGAGTCGCAGTGGCTGTCCCATAA
>probe:Drosophila_2:1629634_at:585:85; Interrogation_Position=4355; Antisense; AGTCGCAGTGGCTGTCCCATAAGTT
>probe:Drosophila_2:1629634_at:104:583; Interrogation_Position=4363; Antisense; TGGCTGTCCCATAAGTTTGCTCATA
>probe:Drosophila_2:1629634_at:727:333; Interrogation_Position=4365; Antisense; GCTGTCCCATAAGTTTGCTCATACA
>probe:Drosophila_2:1629634_at:408:657; Interrogation_Position=4374; Antisense; TAAGTTTGCTCATACAAAACACACA
>probe:Drosophila_2:1629634_at:714:153; Interrogation_Position=4391; Antisense; AACACACATGGGTGTTTCACCGGGA
>probe:Drosophila_2:1629634_at:579:63; Interrogation_Position=4398; Antisense; ATGGGTGTTTCACCGGGATCTCTTG

Paste this into a BLAST search page for me
GATCGCGATCTCAAGCGCGGCAAACTCTCAAGCGCGGCAAACCTTTGTATAAGCGCGGCAAACCTTTGTATTTGAGCGGCAAACCTTTGTATTTGAGCAAGTATTTGAGCAAAGACCGCTTCAATAAAGACCGCTTCAATCTCCTGGAGTAATCTCCTGGAGTCGCAGTGGCTGTTGGAGTCGCAGTGGCTGTCCCATAAAGTCGCAGTGGCTGTCCCATAAGTTTGGCTGTCCCATAAGTTTGCTCATAGCTGTCCCATAAGTTTGCTCATACATAAGTTTGCTCATACAAAACACACAAACACACATGGGTGTTTCACCGGGAATGGGTGTTTCACCGGGATCTCTTG

Full Affymetrix probeset data:

Annotations for 1629634_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime