Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629635_at:

>probe:Drosophila_2:1629635_at:610:401; Interrogation_Position=37; Antisense; GACTTTAAGCTGAGTAAGTATCCTT
>probe:Drosophila_2:1629635_at:597:117; Interrogation_Position=44; Antisense; AGCTGAGTAAGTATCCTTGTTTCGT
>probe:Drosophila_2:1629635_at:310:429; Interrogation_Position=48; Antisense; GAGTAAGTATCCTTGTTTCGTAGCG
>probe:Drosophila_2:1629635_at:246:493; Interrogation_Position=50; Antisense; GTAAGTATCCTTGTTTCGTAGCGAG
>probe:Drosophila_2:1629635_at:71:91; Interrogation_Position=53; Antisense; AGTATCCTTGTTTCGTAGCGAGGTA
>probe:Drosophila_2:1629635_at:349:45; Interrogation_Position=56; Antisense; ATCCTTGTTTCGTAGCGAGGTAGAA
>probe:Drosophila_2:1629635_at:591:453; Interrogation_Position=590; Antisense; TGTTACTTCTTGAGGTAAGTTTTCT
>probe:Drosophila_2:1629635_at:557:479; Interrogation_Position=62; Antisense; GTTTCGTAGCGAGGTAGAACTGCAA
>probe:Drosophila_2:1629635_at:27:293; Interrogation_Position=66; Antisense; CGTAGCGAGGTAGAACTGCAATGTT
>probe:Drosophila_2:1629635_at:344:433; Interrogation_Position=72; Antisense; GAGGTAGAACTGCAATGTTCCCGTT
>probe:Drosophila_2:1629635_at:260:483; Interrogation_Position=75; Antisense; GTAGAACTGCAATGTTCCCGTTTTT
>probe:Drosophila_2:1629635_at:439:383; Interrogation_Position=78; Antisense; GAACTGCAATGTTCCCGTTTTTAGT
>probe:Drosophila_2:1629635_at:25:369; Interrogation_Position=82; Antisense; TGCAATGTTCCCGTTTTTAGTCCGT
>probe:Drosophila_2:1629635_at:500:361; Interrogation_Position=83; Antisense; GCAATGTTCCCGTTTTTAGTCCGTG

Paste this into a BLAST search page for me
GACTTTAAGCTGAGTAAGTATCCTTAGCTGAGTAAGTATCCTTGTTTCGTGAGTAAGTATCCTTGTTTCGTAGCGGTAAGTATCCTTGTTTCGTAGCGAGAGTATCCTTGTTTCGTAGCGAGGTAATCCTTGTTTCGTAGCGAGGTAGAATGTTACTTCTTGAGGTAAGTTTTCTGTTTCGTAGCGAGGTAGAACTGCAACGTAGCGAGGTAGAACTGCAATGTTGAGGTAGAACTGCAATGTTCCCGTTGTAGAACTGCAATGTTCCCGTTTTTGAACTGCAATGTTCCCGTTTTTAGTTGCAATGTTCCCGTTTTTAGTCCGTGCAATGTTCCCGTTTTTAGTCCGTG

Full Affymetrix probeset data:

Annotations for 1629635_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime