Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629637_at:

>probe:Drosophila_2:1629637_at:239:267; Interrogation_Position=1042; Antisense; CAGGAGGTAACCTTTGGGCTAATCG
>probe:Drosophila_2:1629637_at:437:157; Interrogation_Position=1101; Antisense; AAATCATGGAATTACTTTCTTTTCG
>probe:Drosophila_2:1629637_at:595:563; Interrogation_Position=1318; Antisense; GGAATATTAGTGTGCTACATGGAGC
>probe:Drosophila_2:1629637_at:512:419; Interrogation_Position=1339; Antisense; GAGCACATTTATTCCTCAGCAATCG
>probe:Drosophila_2:1629637_at:495:649; Interrogation_Position=1354; Antisense; TCAGCAATCGTCCTCGGAATGTCCA
>probe:Drosophila_2:1629637_at:390:503; Interrogation_Position=1363; Antisense; GTCCTCGGAATGTCCATCATACTAG
>probe:Drosophila_2:1629637_at:293:29; Interrogation_Position=1381; Antisense; ATACTAGTGATTTTGCCCATACTGG
>probe:Drosophila_2:1629637_at:622:319; Interrogation_Position=1395; Antisense; GCCCATACTGGCTATTCCTGGTTAT
>probe:Drosophila_2:1629637_at:487:631; Interrogation_Position=1410; Antisense; TCCTGGTTATGGAATCTACTACATA
>probe:Drosophila_2:1629637_at:226:23; Interrogation_Position=1432; Antisense; ATATACCGTAGCACTGGATCCTTTT
>probe:Drosophila_2:1629637_at:446:113; Interrogation_Position=1441; Antisense; AGCACTGGATCCTTTTGCGAACGCT
>probe:Drosophila_2:1629637_at:661:377; Interrogation_Position=1531; Antisense; GAAGCTGTTAGCAATACGGATATGA
>probe:Drosophila_2:1629637_at:184:141; Interrogation_Position=1546; Antisense; ACGGATATGACCCAACAGCTTACTG
>probe:Drosophila_2:1629637_at:63:681; Interrogation_Position=1551; Antisense; TATGACCCAACAGCTTACTGCCGGA

Paste this into a BLAST search page for me
CAGGAGGTAACCTTTGGGCTAATCGAAATCATGGAATTACTTTCTTTTCGGGAATATTAGTGTGCTACATGGAGCGAGCACATTTATTCCTCAGCAATCGTCAGCAATCGTCCTCGGAATGTCCAGTCCTCGGAATGTCCATCATACTAGATACTAGTGATTTTGCCCATACTGGGCCCATACTGGCTATTCCTGGTTATTCCTGGTTATGGAATCTACTACATAATATACCGTAGCACTGGATCCTTTTAGCACTGGATCCTTTTGCGAACGCTGAAGCTGTTAGCAATACGGATATGAACGGATATGACCCAACAGCTTACTGTATGACCCAACAGCTTACTGCCGGA

Full Affymetrix probeset data:

Annotations for 1629637_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime