Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629638_at:

>probe:Drosophila_2:1629638_at:574:157; Interrogation_Position=2326; Antisense; AAGAGTATTTACTGCGGAACGCCGG
>probe:Drosophila_2:1629638_at:395:253; Interrogation_Position=2364; Antisense; CAAGCAGCTTATATCTTTGGACGAT
>probe:Drosophila_2:1629638_at:665:57; Interrogation_Position=2387; Antisense; ATGAGTATCTGCACTGCGCCGAGGA
>probe:Drosophila_2:1629638_at:617:155; Interrogation_Position=2445; Antisense; ACAGCTTACAGATGTCCGATTCCGA
>probe:Drosophila_2:1629638_at:593:173; Interrogation_Position=2485; Antisense; AAAGCGGGCATGTTGACCCTATGCT
>probe:Drosophila_2:1629638_at:363:51; Interrogation_Position=2505; Antisense; ATGCTGGTATGTCTCCGGCTTTTCA
>probe:Drosophila_2:1629638_at:365:289; Interrogation_Position=2520; Antisense; CGGCTTTTCAGACGTCTCAGACTTC
>probe:Drosophila_2:1629638_at:332:279; Interrogation_Position=2535; Antisense; CTCAGACTTCCACGTTTATATCCGA
>probe:Drosophila_2:1629638_at:622:441; Interrogation_Position=2572; Antisense; GATGTGCTTCACCAGTCGGACTATG
>probe:Drosophila_2:1629638_at:114:685; Interrogation_Position=2599; Antisense; TATAACAATCGTACTGCCCAAATCC
>probe:Drosophila_2:1629638_at:380:161; Interrogation_Position=2703; Antisense; AAATACGCGCAAGTGGTTCTCCGGG
>probe:Drosophila_2:1629638_at:207:391; Interrogation_Position=2777; Antisense; GAAACTTTCAGGTCCGCGGTGGCGT
>probe:Drosophila_2:1629638_at:326:279; Interrogation_Position=2821; Antisense; CTACCTCGTTGCCTTTTGTATATAA
>probe:Drosophila_2:1629638_at:555:31; Interrogation_Position=2842; Antisense; ATAATACTCGTTTTGTTTGTTGCCA

Paste this into a BLAST search page for me
AAGAGTATTTACTGCGGAACGCCGGCAAGCAGCTTATATCTTTGGACGATATGAGTATCTGCACTGCGCCGAGGAACAGCTTACAGATGTCCGATTCCGAAAAGCGGGCATGTTGACCCTATGCTATGCTGGTATGTCTCCGGCTTTTCACGGCTTTTCAGACGTCTCAGACTTCCTCAGACTTCCACGTTTATATCCGAGATGTGCTTCACCAGTCGGACTATGTATAACAATCGTACTGCCCAAATCCAAATACGCGCAAGTGGTTCTCCGGGGAAACTTTCAGGTCCGCGGTGGCGTCTACCTCGTTGCCTTTTGTATATAAATAATACTCGTTTTGTTTGTTGCCA

Full Affymetrix probeset data:

Annotations for 1629638_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime