FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629639_at:

>probe:Drosophila_2:1629639_at:36:59; Interrogation_Position=13; Antisense; ATGATTTTGCTGCTGGGCACGCACT
>probe:Drosophila_2:1629639_at:705:463; Interrogation_Position=133; Antisense; GATTCGCAGCGAAATCTGCTTCCGG
>probe:Drosophila_2:1629639_at:642:237; Interrogation_Position=145; Antisense; AATCTGCTTCCGGTTCGTCGAAGGC
>probe:Drosophila_2:1629639_at:728:633; Interrogation_Position=162; Antisense; TCGAAGGCGTGGCATCTTCTTCAGC
>probe:Drosophila_2:1629639_at:39:347; Interrogation_Position=191; Antisense; GCATCGGCGGATTGCCGTTCCTCAA
>probe:Drosophila_2:1629639_at:594:521; Interrogation_Position=218; Antisense; GGGCCAGTGGCTATTCTTGGGCATA
>probe:Drosophila_2:1629639_at:114:689; Interrogation_Position=229; Antisense; TATTCTTGGGCATATCCTGGCTATC
>probe:Drosophila_2:1629639_at:155:23; Interrogation_Position=240; Antisense; ATATCCTGGCTATCCGTACAACTAC
>probe:Drosophila_2:1629639_at:241:491; Interrogation_Position=255; Antisense; GTACAACTACTATGGCTCACCATCG
>probe:Drosophila_2:1629639_at:143:271; Interrogation_Position=275; Antisense; CATCGCCTGGCTATTATGGTTATGG
>probe:Drosophila_2:1629639_at:332:45; Interrogation_Position=311; Antisense; ATCCCGGCTACCTGGGCTATCAGAA
>probe:Drosophila_2:1629639_at:214:641; Interrogation_Position=49; Antisense; TCGGCTGTTGACAAGGATGTGGCAC
>probe:Drosophila_2:1629639_at:106:443; Interrogation_Position=64; Antisense; GATGTGGCACCAGTTGGCTATGTAA
>probe:Drosophila_2:1629639_at:9:181; Interrogation_Position=87; Antisense; AAAAACGGATTTGCTGTCATTGGAG

Paste this into a BLAST search page for me
ATGATTTTGCTGCTGGGCACGCACTGATTCGCAGCGAAATCTGCTTCCGGAATCTGCTTCCGGTTCGTCGAAGGCTCGAAGGCGTGGCATCTTCTTCAGCGCATCGGCGGATTGCCGTTCCTCAAGGGCCAGTGGCTATTCTTGGGCATATATTCTTGGGCATATCCTGGCTATCATATCCTGGCTATCCGTACAACTACGTACAACTACTATGGCTCACCATCGCATCGCCTGGCTATTATGGTTATGGATCCCGGCTACCTGGGCTATCAGAATCGGCTGTTGACAAGGATGTGGCACGATGTGGCACCAGTTGGCTATGTAAAAAAACGGATTTGCTGTCATTGGAG

Full Affymetrix probeset data:

Annotations for 1629639_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720