Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629642_a_at:

>probe:Drosophila_2:1629642_a_at:577:307; Interrogation_Position=383; Antisense; CCTTCATTGGCTACGGCCTGCTGAA
>probe:Drosophila_2:1629642_a_at:268:643; Interrogation_Position=431; Antisense; TCTACAGCGCTGAGAACCCCAATGG
>probe:Drosophila_2:1629642_a_at:349:555; Interrogation_Position=499; Antisense; GGACTGGCCGTGGAGTTCCTGATCA
>probe:Drosophila_2:1629642_a_at:285:209; Interrogation_Position=577; Antisense; AAGCAGGACTCGCTGCCAGTGCGAT
>probe:Drosophila_2:1629642_a_at:127:21; Interrogation_Position=600; Antisense; ATTTGGTCTGGCCATCGCATGCCTG
>probe:Drosophila_2:1629642_a_at:544:49; Interrogation_Position=618; Antisense; ATGCCTGTCGCTCACAGCGGGACAA
>probe:Drosophila_2:1629642_a_at:332:89; Interrogation_Position=655; Antisense; AGTATGAATCCAGTCCGATCCTTTG
>probe:Drosophila_2:1629642_a_at:55:695; Interrogation_Position=676; Antisense; TTTGCTCCGGCCATTTGGAACGGAT
>probe:Drosophila_2:1629642_a_at:216:463; Interrogation_Position=698; Antisense; GATTCTGGGATGACCACTGGATCTA
>probe:Drosophila_2:1629642_a_at:590:33; Interrogation_Position=751; Antisense; ATCACCTCGGTGATCTACAAGCACG
>probe:Drosophila_2:1629642_a_at:190:409; Interrogation_Position=816; Antisense; GACGATGTCAACCAAGAGGACCTCG
>probe:Drosophila_2:1629642_a_at:309:331; Interrogation_Position=844; Antisense; GCGGAGCTCGCCTAAATGGATTTAC
>probe:Drosophila_2:1629642_a_at:300:711; Interrogation_Position=891; Antisense; TTAAGTTCGTGTTCGTGAGAGCGGA
>probe:Drosophila_2:1629642_a_at:415:457; Interrogation_Position=923; Antisense; GATAGTTTTAAGTTGCGAAGCGTGC

Paste this into a BLAST search page for me
CCTTCATTGGCTACGGCCTGCTGAATCTACAGCGCTGAGAACCCCAATGGGGACTGGCCGTGGAGTTCCTGATCAAAGCAGGACTCGCTGCCAGTGCGATATTTGGTCTGGCCATCGCATGCCTGATGCCTGTCGCTCACAGCGGGACAAAGTATGAATCCAGTCCGATCCTTTGTTTGCTCCGGCCATTTGGAACGGATGATTCTGGGATGACCACTGGATCTAATCACCTCGGTGATCTACAAGCACGGACGATGTCAACCAAGAGGACCTCGGCGGAGCTCGCCTAAATGGATTTACTTAAGTTCGTGTTCGTGAGAGCGGAGATAGTTTTAAGTTGCGAAGCGTGC

Full Affymetrix probeset data:

Annotations for 1629642_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime