FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629646_at:

>probe:Drosophila_2:1629646_at:310:703; Interrogation_Position=1085; Antisense; TTACTCTCACGGCTGGTGGAGTGTT
>probe:Drosophila_2:1629646_at:217:729; Interrogation_Position=1132; Antisense; TTGGCTATGGTGAAGCTGGCATTTT
>probe:Drosophila_2:1629646_at:246:283; Interrogation_Position=1147; Antisense; CTGGCATTTTCTGTGGTTACGGTAA
>probe:Drosophila_2:1629646_at:214:435; Interrogation_Position=1212; Antisense; GAGGGACGAGCTCTGCTACTATTAT
>probe:Drosophila_2:1629646_at:248:431; Interrogation_Position=727; Antisense; GAGTACTTGGAGGAGCTCACCGAGT
>probe:Drosophila_2:1629646_at:376:339; Interrogation_Position=741; Antisense; GCTCACCGAGTGCATTCGGGATCAT
>probe:Drosophila_2:1629646_at:25:529; Interrogation_Position=758; Antisense; GGGATCATCGATTGCTATTGGACTA
>probe:Drosophila_2:1629646_at:85:621; Interrogation_Position=794; Antisense; TGCGACCCGTCTTTTCGGGAACCAT
>probe:Drosophila_2:1629646_at:341:473; Interrogation_Position=876; Antisense; GTTCTTCTCGACATTTTGGACTGGT
>probe:Drosophila_2:1629646_at:542:589; Interrogation_Position=897; Antisense; TGGTGTCGCCACTTGCCTTTTTATG
>probe:Drosophila_2:1629646_at:355:627; Interrogation_Position=910; Antisense; TGCCTTTTTATGTTCGACGTGTCCA
>probe:Drosophila_2:1629646_at:444:515; Interrogation_Position=928; Antisense; GTGTCCATGGAGACGTTCCCCTTTT
>probe:Drosophila_2:1629646_at:392:307; Interrogation_Position=984; Antisense; CCAGGAAATGTCCAATTGCCTCTTT
>probe:Drosophila_2:1629646_at:571:247; Interrogation_Position=996; Antisense; CAATTGCCTCTTTCAATCGGACTGG

Paste this into a BLAST search page for me
TTACTCTCACGGCTGGTGGAGTGTTTTGGCTATGGTGAAGCTGGCATTTTCTGGCATTTTCTGTGGTTACGGTAAGAGGGACGAGCTCTGCTACTATTATGAGTACTTGGAGGAGCTCACCGAGTGCTCACCGAGTGCATTCGGGATCATGGGATCATCGATTGCTATTGGACTATGCGACCCGTCTTTTCGGGAACCATGTTCTTCTCGACATTTTGGACTGGTTGGTGTCGCCACTTGCCTTTTTATGTGCCTTTTTATGTTCGACGTGTCCAGTGTCCATGGAGACGTTCCCCTTTTCCAGGAAATGTCCAATTGCCTCTTTCAATTGCCTCTTTCAATCGGACTGG

Full Affymetrix probeset data:

Annotations for 1629646_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720