FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629647_at:

>probe:Drosophila_2:1629647_at:316:1; Interrogation_Position=164; Antisense; AGTACGCCAAGGTGGAACTGACGCC
>probe:Drosophila_2:1629647_at:6:459; Interrogation_Position=202; Antisense; GATATTCCGGCCATTCGCCAAGGAC
>probe:Drosophila_2:1629647_at:547:221; Interrogation_Position=241; Antisense; AAGGGAGCCAAGACCGGCGCCTACA
>probe:Drosophila_2:1629647_at:266:159; Interrogation_Position=263; Antisense; ACAAGAACCTCACGGTTCGCGAGGC
>probe:Drosophila_2:1629647_at:694:437; Interrogation_Position=283; Antisense; GAGGCCTGGCTTAACACCCTGGTGA
>probe:Drosophila_2:1629647_at:248:435; Interrogation_Position=313; Antisense; GAGGTCATCTTCTGGTTCTACATCG
>probe:Drosophila_2:1629647_at:259:643; Interrogation_Position=329; Antisense; TCTACATCGGCGAGTGCATCGGCAA
>probe:Drosophila_2:1629647_at:208:347; Interrogation_Position=344; Antisense; GCATCGGCAAGCGTCACATTGTAGG
>probe:Drosophila_2:1629647_at:407:117; Interrogation_Position=381; Antisense; AGCTTACTATAGTCTCCGCTTGGCA
>probe:Drosophila_2:1629647_at:603:583; Interrogation_Position=401; Antisense; TGGCAGTCACTGGAATGGGCAACGT
>probe:Drosophila_2:1629647_at:279:353; Interrogation_Position=419; Antisense; GCAACGTAATCCCTAACAGATGTGT
>probe:Drosophila_2:1629647_at:323:61; Interrogation_Position=452; Antisense; ATGTCTGCGAACATTTCGACTCTGA
>probe:Drosophila_2:1629647_at:86:465; Interrogation_Position=541; Antisense; GTTAGAACGTTTGCGCGGGATTTGT
>probe:Drosophila_2:1629647_at:488:197; Interrogation_Position=676; Antisense; AACGGTGTCGTAATCAAAGAGGCTA

Paste this into a BLAST search page for me
AGTACGCCAAGGTGGAACTGACGCCGATATTCCGGCCATTCGCCAAGGACAAGGGAGCCAAGACCGGCGCCTACAACAAGAACCTCACGGTTCGCGAGGCGAGGCCTGGCTTAACACCCTGGTGAGAGGTCATCTTCTGGTTCTACATCGTCTACATCGGCGAGTGCATCGGCAAGCATCGGCAAGCGTCACATTGTAGGAGCTTACTATAGTCTCCGCTTGGCATGGCAGTCACTGGAATGGGCAACGTGCAACGTAATCCCTAACAGATGTGTATGTCTGCGAACATTTCGACTCTGAGTTAGAACGTTTGCGCGGGATTTGTAACGGTGTCGTAATCAAAGAGGCTA

Full Affymetrix probeset data:

Annotations for 1629647_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720