FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629649_at:

>probe:Drosophila_2:1629649_at:706:239; Interrogation_Position=368; Antisense; AATAAGCCCAATCAACAACACAACG
>probe:Drosophila_2:1629649_at:315:181; Interrogation_Position=496; Antisense; AAAAACACAATTGCATGACGACGGT
>probe:Drosophila_2:1629649_at:450:365; Interrogation_Position=572; Antisense; GAATACCACAAACCACAATGTCCAG
>probe:Drosophila_2:1629649_at:535:229; Interrogation_Position=588; Antisense; AATGTCCAGGTGTGACAACCACAAA
>probe:Drosophila_2:1629649_at:512:637; Interrogation_Position=721; Antisense; TCGAGCAACTCGGATCTGGGCGGCA
>probe:Drosophila_2:1629649_at:677:451; Interrogation_Position=733; Antisense; GATCTGGGCGGCAGTGAGTCCTTCC
>probe:Drosophila_2:1629649_at:135:85; Interrogation_Position=745; Antisense; AGTGAGTCCTTCCTGCAATATTGCA
>probe:Drosophila_2:1629649_at:253:615; Interrogation_Position=758; Antisense; TGCAATATTGCAGCGATAGCGAAAA
>probe:Drosophila_2:1629649_at:632:323; Interrogation_Position=776; Antisense; GCGAAAAGAGGCCACCACCGATTGT
>probe:Drosophila_2:1629649_at:283:669; Interrogation_Position=830; Antisense; TACGTCGGGTGGTGCGCACCGCAAC
>probe:Drosophila_2:1629649_at:568:199; Interrogation_Position=852; Antisense; AACGCGGCACGTCACCGTGGTCAGT
>probe:Drosophila_2:1629649_at:391:647; Interrogation_Position=872; Antisense; TCAGTCTGTCCACCCGGCACAAGGA
>probe:Drosophila_2:1629649_at:207:635; Interrogation_Position=913; Antisense; TCGCACCATGTGACGGCCGTCAGAC
>probe:Drosophila_2:1629649_at:685:317; Interrogation_Position=928; Antisense; GCCGTCAGACAGATGGAGTGCGCAT

Paste this into a BLAST search page for me
AATAAGCCCAATCAACAACACAACGAAAAACACAATTGCATGACGACGGTGAATACCACAAACCACAATGTCCAGAATGTCCAGGTGTGACAACCACAAATCGAGCAACTCGGATCTGGGCGGCAGATCTGGGCGGCAGTGAGTCCTTCCAGTGAGTCCTTCCTGCAATATTGCATGCAATATTGCAGCGATAGCGAAAAGCGAAAAGAGGCCACCACCGATTGTTACGTCGGGTGGTGCGCACCGCAACAACGCGGCACGTCACCGTGGTCAGTTCAGTCTGTCCACCCGGCACAAGGATCGCACCATGTGACGGCCGTCAGACGCCGTCAGACAGATGGAGTGCGCAT

Full Affymetrix probeset data:

Annotations for 1629649_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720