FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629650_at:

>probe:Drosophila_2:1629650_at:83:415; Interrogation_Position=2417; Antisense; GACCACCAATGGTTACTCCACAGAT
>probe:Drosophila_2:1629650_at:200:59; Interrogation_Position=2445; Antisense; ATGATCATCACGAGTTGTCCGTCGG
>probe:Drosophila_2:1629650_at:340:639; Interrogation_Position=2466; Antisense; TCGGCGGAGCAAGTTTCCATACTTT
>probe:Drosophila_2:1629650_at:55:629; Interrogation_Position=2481; Antisense; TCCATACTTTTATCCAGTGCCAGCA
>probe:Drosophila_2:1629650_at:439:87; Interrogation_Position=2496; Antisense; AGTGCCAGCATTTTGGCCGCCGAGG
>probe:Drosophila_2:1629650_at:723:81; Interrogation_Position=2518; Antisense; AGGGAGTCGCCAGCTTTGCAGCAGC
>probe:Drosophila_2:1629650_at:284:353; Interrogation_Position=2541; Antisense; GCAGCGCGCAAAATCAGCACGTCGT
>probe:Drosophila_2:1629650_at:79:135; Interrogation_Position=2559; Antisense; ACGTCGTCGTCAGTGGAAGGTTCCA
>probe:Drosophila_2:1629650_at:32:209; Interrogation_Position=2595; Antisense; AAGCTAAGCGCGATGTCCAACAAAT
>probe:Drosophila_2:1629650_at:159:215; Interrogation_Position=2641; Antisense; AAGTTGAAGAAGTCGCTGGCCAGAT
>probe:Drosophila_2:1629650_at:599:311; Interrogation_Position=2659; Antisense; GCCAGATCGAAGTGGTGCCCGCAGA
>probe:Drosophila_2:1629650_at:552:109; Interrogation_Position=2681; Antisense; AGAAGTACAACCTCCTGCCAAGATC
>probe:Drosophila_2:1629650_at:57:359; Interrogation_Position=2729; Antisense; GCAAACGCAGGCCAATTCCGAATAA
>probe:Drosophila_2:1629650_at:177:471; Interrogation_Position=2835; Antisense; GTTCGCAATAGGGTCGATTCCCTTA

Paste this into a BLAST search page for me
GACCACCAATGGTTACTCCACAGATATGATCATCACGAGTTGTCCGTCGGTCGGCGGAGCAAGTTTCCATACTTTTCCATACTTTTATCCAGTGCCAGCAAGTGCCAGCATTTTGGCCGCCGAGGAGGGAGTCGCCAGCTTTGCAGCAGCGCAGCGCGCAAAATCAGCACGTCGTACGTCGTCGTCAGTGGAAGGTTCCAAAGCTAAGCGCGATGTCCAACAAATAAGTTGAAGAAGTCGCTGGCCAGATGCCAGATCGAAGTGGTGCCCGCAGAAGAAGTACAACCTCCTGCCAAGATCGCAAACGCAGGCCAATTCCGAATAAGTTCGCAATAGGGTCGATTCCCTTA

Full Affymetrix probeset data:

Annotations for 1629650_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720