FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629653_at:

>probe:Drosophila_2:1629653_at:165:121; Interrogation_Position=328; Antisense; AGCTGTGTGCTCAATGTTGTTCTCT
>probe:Drosophila_2:1629653_at:203:299; Interrogation_Position=360; Antisense; CGCTGGCTTTGGCTTCTACAAGATT
>probe:Drosophila_2:1629653_at:373:83; Interrogation_Position=391; Antisense; AGTGAACATCCTTACGCCTTTACAG
>probe:Drosophila_2:1629653_at:651:595; Interrogation_Position=418; Antisense; TGTGTTTTCGGTTTCTGTCATGGAC
>probe:Drosophila_2:1629653_at:678:495; Interrogation_Position=434; Antisense; GTCATGGACTCTTCGGTTTGGCCAG
>probe:Drosophila_2:1629653_at:535:681; Interrogation_Position=513; Antisense; TATGGAGATCATACCGCTGCCGCTG
>probe:Drosophila_2:1629653_at:302:521; Interrogation_Position=544; Antisense; GTGGAATTGTATTTAGCCGCCGAGA
>probe:Drosophila_2:1629653_at:551:421; Interrogation_Position=567; Antisense; GAGCAACAATATTGCCCTGGGCCAT
>probe:Drosophila_2:1629653_at:314:67; Interrogation_Position=590; Antisense; ATGGACTCTTCATTGTACCGCTGGC
>probe:Drosophila_2:1629653_at:29:459; Interrogation_Position=699; Antisense; GATTTTGGGTAACATCACCTCGCTG
>probe:Drosophila_2:1629653_at:553:297; Interrogation_Position=719; Antisense; CGCTGGCATATCTGGCGATCAATGA
>probe:Drosophila_2:1629653_at:127:275; Interrogation_Position=833; Antisense; GCGGTGAACCGGTGAACTACTTAAG
>probe:Drosophila_2:1629653_at:653:665; Interrogation_Position=850; Antisense; TACTTAAGTTGGTCGGGCTTCTACT
>probe:Drosophila_2:1629653_at:148:315; Interrogation_Position=883; Antisense; GCCATGGCCGTCTCTGGTGAAAAGT

Paste this into a BLAST search page for me
AGCTGTGTGCTCAATGTTGTTCTCTCGCTGGCTTTGGCTTCTACAAGATTAGTGAACATCCTTACGCCTTTACAGTGTGTTTTCGGTTTCTGTCATGGACGTCATGGACTCTTCGGTTTGGCCAGTATGGAGATCATACCGCTGCCGCTGGTGGAATTGTATTTAGCCGCCGAGAGAGCAACAATATTGCCCTGGGCCATATGGACTCTTCATTGTACCGCTGGCGATTTTGGGTAACATCACCTCGCTGCGCTGGCATATCTGGCGATCAATGAGCGGTGAACCGGTGAACTACTTAAGTACTTAAGTTGGTCGGGCTTCTACTGCCATGGCCGTCTCTGGTGAAAAGT

Full Affymetrix probeset data:

Annotations for 1629653_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720