FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629655_at:

>probe:Drosophila_2:1629655_at:219:253; Interrogation_Position=1007; Antisense; CAACTCTATACTGGGCGACGAAGCT
>probe:Drosophila_2:1629655_at:194:137; Interrogation_Position=1024; Antisense; ACGAAGCTCTAGGTCTGATTTTTGC
>probe:Drosophila_2:1629655_at:24:605; Interrogation_Position=1039; Antisense; TGATTTTTGCACAGATCTCGCCAGC
>probe:Drosophila_2:1629655_at:302:297; Interrogation_Position=1127; Antisense; GCCACACCGTAATCTGTTCGTTTTT
>probe:Drosophila_2:1629655_at:461:725; Interrogation_Position=1150; Antisense; TTGACCCAGAGACTTGTGCCGGATA
>probe:Drosophila_2:1629655_at:331:625; Interrogation_Position=1166; Antisense; TGCCGGATACGTTGAGGCCATCGGA
>probe:Drosophila_2:1629655_at:535:471; Interrogation_Position=683; Antisense; GTTCTACTTTGCCAGTCTGCAGAAG
>probe:Drosophila_2:1629655_at:288:483; Interrogation_Position=770; Antisense; GTATGAAACCGTGTCCATTCCAACG
>probe:Drosophila_2:1629655_at:495:513; Interrogation_Position=799; Antisense; GTGATGTGGATTATCCCGGCTACTC
>probe:Drosophila_2:1629655_at:83:643; Interrogation_Position=822; Antisense; TCTGCCTGGCTTGATTTCGATGTTA
>probe:Drosophila_2:1629655_at:666:473; Interrogation_Position=843; Antisense; GTTACCGAGCCTAGTTATTTGCGAA
>probe:Drosophila_2:1629655_at:661:247; Interrogation_Position=878; Antisense; CAATGGCCCGGGTGTTTTGCTATTA
>probe:Drosophila_2:1629655_at:186:83; Interrogation_Position=903; Antisense; AGTGTCCTGCAAAAGTTCCGCACAA
>probe:Drosophila_2:1629655_at:676:103; Interrogation_Position=952; Antisense; AGACCCGAGAAGCTGACCTGGAATT

Paste this into a BLAST search page for me
CAACTCTATACTGGGCGACGAAGCTACGAAGCTCTAGGTCTGATTTTTGCTGATTTTTGCACAGATCTCGCCAGCGCCACACCGTAATCTGTTCGTTTTTTTGACCCAGAGACTTGTGCCGGATATGCCGGATACGTTGAGGCCATCGGAGTTCTACTTTGCCAGTCTGCAGAAGGTATGAAACCGTGTCCATTCCAACGGTGATGTGGATTATCCCGGCTACTCTCTGCCTGGCTTGATTTCGATGTTAGTTACCGAGCCTAGTTATTTGCGAACAATGGCCCGGGTGTTTTGCTATTAAGTGTCCTGCAAAAGTTCCGCACAAAGACCCGAGAAGCTGACCTGGAATT

Full Affymetrix probeset data:

Annotations for 1629655_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720