FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629658_at:

>probe:Drosophila_2:1629658_at:177:373; Interrogation_Position=2173; Antisense; GAAGTGCTCGAGAATTGAACCCAAC
>probe:Drosophila_2:1629658_at:396:611; Interrogation_Position=2188; Antisense; TGAACCCAACCTAACCGACTATTGT
>probe:Drosophila_2:1629658_at:579:361; Interrogation_Position=2230; Antisense; GCAATGCTTATTTATGTGTACGATT
>probe:Drosophila_2:1629658_at:503:487; Interrogation_Position=2247; Antisense; GTACGATTATTTAAACTAGCGACTA
>probe:Drosophila_2:1629658_at:632:325; Interrogation_Position=2265; Antisense; GCGACTAATAGATGTATCACCCTAA
>probe:Drosophila_2:1629658_at:672:179; Interrogation_Position=2309; Antisense; AAACACAACAGAACTCCATTGCGAG
>probe:Drosophila_2:1629658_at:252:325; Interrogation_Position=2329; Antisense; GCGAGTTCGATGATAAGGCTGTGAT
>probe:Drosophila_2:1629658_at:99:71; Interrogation_Position=2344; Antisense; AGGCTGTGATTCTACACTCATGAAG
>probe:Drosophila_2:1629658_at:454:103; Interrogation_Position=2413; Antisense; AGACCTTAGATGTTAGTTGCATTGA
>probe:Drosophila_2:1629658_at:325:723; Interrogation_Position=2446; Antisense; TTGACAGAATTGTTTCTCACCTTCT
>probe:Drosophila_2:1629658_at:36:643; Interrogation_Position=2460; Antisense; TCTCACCTTCTGTTTCTTAGTTTGT
>probe:Drosophila_2:1629658_at:52:699; Interrogation_Position=2504; Antisense; TTTACTTTTTTATTGAGACCATGCA
>probe:Drosophila_2:1629658_at:208:425; Interrogation_Position=2518; Antisense; GAGACCATGCAATGACAAGTTGTAA
>probe:Drosophila_2:1629658_at:341:237; Interrogation_Position=2583; Antisense; AATCTACTTGTAGTCCTCTTCAAAA

Paste this into a BLAST search page for me
GAAGTGCTCGAGAATTGAACCCAACTGAACCCAACCTAACCGACTATTGTGCAATGCTTATTTATGTGTACGATTGTACGATTATTTAAACTAGCGACTAGCGACTAATAGATGTATCACCCTAAAAACACAACAGAACTCCATTGCGAGGCGAGTTCGATGATAAGGCTGTGATAGGCTGTGATTCTACACTCATGAAGAGACCTTAGATGTTAGTTGCATTGATTGACAGAATTGTTTCTCACCTTCTTCTCACCTTCTGTTTCTTAGTTTGTTTTACTTTTTTATTGAGACCATGCAGAGACCATGCAATGACAAGTTGTAAAATCTACTTGTAGTCCTCTTCAAAA

Full Affymetrix probeset data:

Annotations for 1629658_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720