FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629660_at:

>probe:Drosophila_2:1629660_at:715:537; Interrogation_Position=114; Antisense; GGTACTGGGCATCTCGTACTACTAC
>probe:Drosophila_2:1629660_at:569:489; Interrogation_Position=129; Antisense; GTACTACTACTACTTTCGCGAATCT
>probe:Drosophila_2:1629660_at:286:437; Interrogation_Position=225; Antisense; GAGGATGTTTTCAAGTGCCCTGCCC
>probe:Drosophila_2:1629660_at:312:173; Interrogation_Position=279; Antisense; AAACCTTCGCGGCAATGAGTCGTCC
>probe:Drosophila_2:1629660_at:656:569; Interrogation_Position=306; Antisense; GGCATCGCTCTTACTGGAGACAGGC
>probe:Drosophila_2:1629660_at:703:641; Interrogation_Position=332; Antisense; TCTGCTGTTTGGTGCTGGATCTGAC
>probe:Drosophila_2:1629660_at:581:589; Interrogation_Position=347; Antisense; TGGATCTGACCCTTAGCAAACTGTG
>probe:Drosophila_2:1629660_at:684:177; Interrogation_Position=364; Antisense; AAACTGTGGCATCGCATAGAGTCCC
>probe:Drosophila_2:1629660_at:447:85; Interrogation_Position=395; Antisense; AGTGCGCCATTGTGGGCATACTCCA
>probe:Drosophila_2:1629660_at:523:175; Interrogation_Position=440; Antisense; AAACCTTCCTGGTCTGCGAGTACTG
>probe:Drosophila_2:1629660_at:98:91; Interrogation_Position=458; Antisense; AGTACTGGACTTTGGGCCTGACTAC
>probe:Drosophila_2:1629660_at:387:41; Interrogation_Position=490; Antisense; ATCGGCGCATGTCTTCTGTGGCTTT
>probe:Drosophila_2:1629660_at:57:527; Interrogation_Position=648; Antisense; GGGAAGCGCACAGAGCTTTGCCAAT
>probe:Drosophila_2:1629660_at:719:603; Interrogation_Position=89; Antisense; TGATCATGGCGGTGTTGCTTCACTC

Paste this into a BLAST search page for me
GGTACTGGGCATCTCGTACTACTACGTACTACTACTACTTTCGCGAATCTGAGGATGTTTTCAAGTGCCCTGCCCAAACCTTCGCGGCAATGAGTCGTCCGGCATCGCTCTTACTGGAGACAGGCTCTGCTGTTTGGTGCTGGATCTGACTGGATCTGACCCTTAGCAAACTGTGAAACTGTGGCATCGCATAGAGTCCCAGTGCGCCATTGTGGGCATACTCCAAAACCTTCCTGGTCTGCGAGTACTGAGTACTGGACTTTGGGCCTGACTACATCGGCGCATGTCTTCTGTGGCTTTGGGAAGCGCACAGAGCTTTGCCAATTGATCATGGCGGTGTTGCTTCACTC

Full Affymetrix probeset data:

Annotations for 1629660_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720