FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629661_at:

>probe:Drosophila_2:1629661_at:217:81; Interrogation_Position=122; Antisense; AGGTGCGGCACAGGATCTACCAGAT
>probe:Drosophila_2:1629661_at:356:403; Interrogation_Position=148; Antisense; GACTTGTCCTGGGAGAGGATCTCAT
>probe:Drosophila_2:1629661_at:665:429; Interrogation_Position=15; Antisense; GAGTCTGGACTACACGAACTTGTTG
>probe:Drosophila_2:1629661_at:24:39; Interrogation_Position=166; Antisense; ATCTCATTGGTGTATAGCTGCGCCG
>probe:Drosophila_2:1629661_at:504:603; Interrogation_Position=197; Antisense; TGATTCTGATACTGACCCTGGTAAT
>probe:Drosophila_2:1629661_at:419:589; Interrogation_Position=215; Antisense; TGGTAATCTACTACTCCTGGATGGC
>probe:Drosophila_2:1629661_at:496:631; Interrogation_Position=229; Antisense; TCCTGGATGGCCATGGTTCTGATTT
>probe:Drosophila_2:1629661_at:193:9; Interrogation_Position=263; Antisense; ATTGCGTATATTATAGCGCCTCGAA
>probe:Drosophila_2:1629661_at:66:429; Interrogation_Position=294; Antisense; GAGATTCCTGTTCGACCTGTACAGA
>probe:Drosophila_2:1629661_at:436:191; Interrogation_Position=31; Antisense; AACTTGTTGCTGAACTGCCTGGCGA
>probe:Drosophila_2:1629661_at:264:583; Interrogation_Position=50; Antisense; TGGCGAACTTCTACCACGCGATCTA
>probe:Drosophila_2:1629661_at:323:453; Interrogation_Position=69; Antisense; GATCTACTTCTACGTGTCACTCTTT
>probe:Drosophila_2:1629661_at:557:515; Interrogation_Position=82; Antisense; GTGTCACTCTTTTCGATGTCCTACT
>probe:Drosophila_2:1629661_at:501:61; Interrogation_Position=97; Antisense; ATGTCCTACTGCGTTGTACTGTGGC

Paste this into a BLAST search page for me
AGGTGCGGCACAGGATCTACCAGATGACTTGTCCTGGGAGAGGATCTCATGAGTCTGGACTACACGAACTTGTTGATCTCATTGGTGTATAGCTGCGCCGTGATTCTGATACTGACCCTGGTAATTGGTAATCTACTACTCCTGGATGGCTCCTGGATGGCCATGGTTCTGATTTATTGCGTATATTATAGCGCCTCGAAGAGATTCCTGTTCGACCTGTACAGAAACTTGTTGCTGAACTGCCTGGCGATGGCGAACTTCTACCACGCGATCTAGATCTACTTCTACGTGTCACTCTTTGTGTCACTCTTTTCGATGTCCTACTATGTCCTACTGCGTTGTACTGTGGC

Full Affymetrix probeset data:

Annotations for 1629661_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720