FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629662_at:

>probe:Drosophila_2:1629662_at:77:511; Interrogation_Position=290; Antisense; GTGCACAACACTTTCGAGCTGCTGA
>probe:Drosophila_2:1629662_at:83:419; Interrogation_Position=305; Antisense; GAGCTGCTGAACTGCGACGATCACG
>probe:Drosophila_2:1629662_at:422:87; Interrogation_Position=390; Antisense; AGTGCCTGTTGATGCTCTTCGATTC
>probe:Drosophila_2:1629662_at:511:411; Interrogation_Position=490; Antisense; GACGCGCATCCCGAGGACATTTAAA
>probe:Drosophila_2:1629662_at:606:401; Interrogation_Position=505; Antisense; GACATTTAAACGCTTTGCTGGCCTA
>probe:Drosophila_2:1629662_at:305:333; Interrogation_Position=521; Antisense; GCTGGCCTAATGGTGCAATTGCTGC
>probe:Drosophila_2:1629662_at:636:615; Interrogation_Position=543; Antisense; TGCACAAGTTCCAAATTCGCGCCAA
>probe:Drosophila_2:1629662_at:8:11; Interrogation_Position=608; Antisense; ATTACGGATCATGTGCCGGTCGGTT
>probe:Drosophila_2:1629662_at:325:269; Interrogation_Position=646; Antisense; CATGAGCTTCTCTGGCAAACTATTG
>probe:Drosophila_2:1629662_at:198:179; Interrogation_Position=662; Antisense; AAACTATTGCCCAATTGCCGGGATC
>probe:Drosophila_2:1629662_at:276:425; Interrogation_Position=704; Antisense; GAGACGTCGGCCAGCTATGATGAGC
>probe:Drosophila_2:1629662_at:23:533; Interrogation_Position=730; Antisense; GGTGGTCATCGTTATTGGAGCCTTC
>probe:Drosophila_2:1629662_at:6:555; Interrogation_Position=787; Antisense; GGAGCTGTTCTCCATTAGCAACTAT
>probe:Drosophila_2:1629662_at:730:13; Interrogation_Position=800; Antisense; ATTAGCAACTATCCACTTTCGGCGG

Paste this into a BLAST search page for me
GTGCACAACACTTTCGAGCTGCTGAGAGCTGCTGAACTGCGACGATCACGAGTGCCTGTTGATGCTCTTCGATTCGACGCGCATCCCGAGGACATTTAAAGACATTTAAACGCTTTGCTGGCCTAGCTGGCCTAATGGTGCAATTGCTGCTGCACAAGTTCCAAATTCGCGCCAAATTACGGATCATGTGCCGGTCGGTTCATGAGCTTCTCTGGCAAACTATTGAAACTATTGCCCAATTGCCGGGATCGAGACGTCGGCCAGCTATGATGAGCGGTGGTCATCGTTATTGGAGCCTTCGGAGCTGTTCTCCATTAGCAACTATATTAGCAACTATCCACTTTCGGCGG

Full Affymetrix probeset data:

Annotations for 1629662_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720