FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629663_at:

>probe:Drosophila_2:1629663_at:386:233; Interrogation_Position=2089; Antisense; AATGCAGAGGTGACAGGCAGCTTAA
>probe:Drosophila_2:1629663_at:491:373; Interrogation_Position=2115; Antisense; GAAGTCACAGACACTGGAGTCCACC
>probe:Drosophila_2:1629663_at:31:433; Interrogation_Position=2131; Antisense; GAGTCCACCCTGCTTAGCTTCAGTT
>probe:Drosophila_2:1629663_at:289:117; Interrogation_Position=2146; Antisense; AGCTTCAGTTTATCGAGCGTTACTA
>probe:Drosophila_2:1629663_at:260:123; Interrogation_Position=2161; Antisense; AGCGTTACTATGATCATCTGCCTCC
>probe:Drosophila_2:1629663_at:29:109; Interrogation_Position=2201; Antisense; AGAACCATCTCTAAGGGCGCATATA
>probe:Drosophila_2:1629663_at:225:221; Interrogation_Position=2213; Antisense; AAGGGCGCATATATCACCACAATGA
>probe:Drosophila_2:1629663_at:513:443; Interrogation_Position=2256; Antisense; GATGTTCCATCGTTAACACTTCAGC
>probe:Drosophila_2:1629663_at:359:177; Interrogation_Position=2270; Antisense; AACACTTCAGCTGCATATGTCCTTT
>probe:Drosophila_2:1629663_at:486:21; Interrogation_Position=2284; Antisense; ATATGTCCTTTCTCCACTTTCATGT
>probe:Drosophila_2:1629663_at:648:147; Interrogation_Position=2299; Antisense; ACTTTCATGTGGGATCTTCAAAAAT
>probe:Drosophila_2:1629663_at:31:477; Interrogation_Position=2453; Antisense; GTTATAGGCTATTCTCTTATACAAA
>probe:Drosophila_2:1629663_at:86:513; Interrogation_Position=2506; Antisense; GTGACGATACGAGCAAATCCGATAC
>probe:Drosophila_2:1629663_at:585:45; Interrogation_Position=2522; Antisense; ATCCGATACGTATGAATATGCACAG

Paste this into a BLAST search page for me
AATGCAGAGGTGACAGGCAGCTTAAGAAGTCACAGACACTGGAGTCCACCGAGTCCACCCTGCTTAGCTTCAGTTAGCTTCAGTTTATCGAGCGTTACTAAGCGTTACTATGATCATCTGCCTCCAGAACCATCTCTAAGGGCGCATATAAAGGGCGCATATATCACCACAATGAGATGTTCCATCGTTAACACTTCAGCAACACTTCAGCTGCATATGTCCTTTATATGTCCTTTCTCCACTTTCATGTACTTTCATGTGGGATCTTCAAAAATGTTATAGGCTATTCTCTTATACAAAGTGACGATACGAGCAAATCCGATACATCCGATACGTATGAATATGCACAG

Full Affymetrix probeset data:

Annotations for 1629663_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720