FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629666_at:

>probe:Drosophila_2:1629666_at:286:195; Interrogation_Position=129; Antisense; AACTGAGGGCACCATGGACGACATC
>probe:Drosophila_2:1629666_at:630:241; Interrogation_Position=155; Antisense; AATACCTGCTGCACCTGGAGGCGAT
>probe:Drosophila_2:1629666_at:253:575; Interrogation_Position=174; Antisense; GGCGATGCGCCGTTTTCAGGAAGAC
>probe:Drosophila_2:1629666_at:33:361; Interrogation_Position=228; Antisense; GCAAGTACGCATTTGGCTGGACGCC
>probe:Drosophila_2:1629666_at:676:571; Interrogation_Position=242; Antisense; GGCTGGACGCCAAGTGTGAGTATCA
>probe:Drosophila_2:1629666_at:593:447; Interrogation_Position=325; Antisense; GATGCCCATCGTGTATCTGATGTGA
>probe:Drosophila_2:1629666_at:537:613; Interrogation_Position=347; Antisense; TGAATCAAGTCGACCAGGCGGCCAA
>probe:Drosophila_2:1629666_at:286:573; Interrogation_Position=363; Antisense; GGCGGCCAAGGATATCGCTAGTTTG
>probe:Drosophila_2:1629666_at:223:315; Interrogation_Position=418; Antisense; GCCATTCTGGACTCCAACGATGTGA
>probe:Drosophila_2:1629666_at:396:377; Interrogation_Position=441; Antisense; GAAGCAGTGCCTGGAACATCTGAAC
>probe:Drosophila_2:1629666_at:694:469; Interrogation_Position=510; Antisense; GTTCGCCCAGAACCAAGAAGCTCTA
>probe:Drosophila_2:1629666_at:616:275; Interrogation_Position=529; Antisense; GCTCTAAGAAGTTTGCGTACCGCCG
>probe:Drosophila_2:1629666_at:636:487; Interrogation_Position=545; Antisense; GTACCGCCGTCGATGGATTGGAGAA
>probe:Drosophila_2:1629666_at:545:157; Interrogation_Position=641; Antisense; ACAACTAGCCGGTCGTCTCAAAAGT

Paste this into a BLAST search page for me
AACTGAGGGCACCATGGACGACATCAATACCTGCTGCACCTGGAGGCGATGGCGATGCGCCGTTTTCAGGAAGACGCAAGTACGCATTTGGCTGGACGCCGGCTGGACGCCAAGTGTGAGTATCAGATGCCCATCGTGTATCTGATGTGATGAATCAAGTCGACCAGGCGGCCAAGGCGGCCAAGGATATCGCTAGTTTGGCCATTCTGGACTCCAACGATGTGAGAAGCAGTGCCTGGAACATCTGAACGTTCGCCCAGAACCAAGAAGCTCTAGCTCTAAGAAGTTTGCGTACCGCCGGTACCGCCGTCGATGGATTGGAGAAACAACTAGCCGGTCGTCTCAAAAGT

Full Affymetrix probeset data:

Annotations for 1629666_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720