FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629667_at:

>probe:Drosophila_2:1629667_at:108:207; Interrogation_Position=111; Antisense; AAGCGGAGGCAGCTCTTCTGGCAAT
>probe:Drosophila_2:1629667_at:309:519; Interrogation_Position=142; Antisense; GTGGTGTCGTGCAAAGAGCTGAACA
>probe:Drosophila_2:1629667_at:204:245; Interrogation_Position=166; Antisense; AATTTCAACTGCTATGTGGGCCGCA
>probe:Drosophila_2:1629667_at:545:61; Interrogation_Position=179; Antisense; ATGTGGGCCGCAACGAGGGTAACTT
>probe:Drosophila_2:1629667_at:57:139; Interrogation_Position=191; Antisense; ACGAGGGTAACTTTTGCAGCAGGAA
>probe:Drosophila_2:1629667_at:94:693; Interrogation_Position=203; Antisense; TTTGCAGCAGGAAGGATCAGACCAA
>probe:Drosophila_2:1629667_at:178:385; Interrogation_Position=21; Antisense; GAAAATCAATCTGACGTTCCTCCGT
>probe:Drosophila_2:1629667_at:11:649; Interrogation_Position=219; Antisense; TCAGACCAAGGTCGTTACACGCTGG
>probe:Drosophila_2:1629667_at:648:637; Interrogation_Position=230; Antisense; TCGTTACACGCTGGTACTTCGACAA
>probe:Drosophila_2:1629667_at:272:497; Interrogation_Position=259; Antisense; GTCTGCAAGCCCTTCAACTATAAAG
>probe:Drosophila_2:1629667_at:217:45; Interrogation_Position=302; Antisense; ATCGCTTCTGCTCGCAGGAAAGCTG
>probe:Drosophila_2:1629667_at:101:207; Interrogation_Position=321; Antisense; AAGCTGCGATGCACGCTGCGGCGAT
>probe:Drosophila_2:1629667_at:474:631; Interrogation_Position=77; Antisense; TCCTGACACAGACCGCGCATATCGA
>probe:Drosophila_2:1629667_at:107:133; Interrogation_Position=88; Antisense; ACCGCGCATATCGAGGCCTTTGGAA

Paste this into a BLAST search page for me
AAGCGGAGGCAGCTCTTCTGGCAATGTGGTGTCGTGCAAAGAGCTGAACAAATTTCAACTGCTATGTGGGCCGCAATGTGGGCCGCAACGAGGGTAACTTACGAGGGTAACTTTTGCAGCAGGAATTTGCAGCAGGAAGGATCAGACCAAGAAAATCAATCTGACGTTCCTCCGTTCAGACCAAGGTCGTTACACGCTGGTCGTTACACGCTGGTACTTCGACAAGTCTGCAAGCCCTTCAACTATAAAGATCGCTTCTGCTCGCAGGAAAGCTGAAGCTGCGATGCACGCTGCGGCGATTCCTGACACAGACCGCGCATATCGAACCGCGCATATCGAGGCCTTTGGAA

Full Affymetrix probeset data:

Annotations for 1629667_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720