FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629671_at:

>probe:Drosophila_2:1629671_at:154:429; Interrogation_Position=271; Antisense; GAGTTCACAATTCGGCTCGGGCAGA
>probe:Drosophila_2:1629671_at:108:335; Interrogation_Position=305; Antisense; GCTGCTCGTCGAGTTGTTGGTACAA
>probe:Drosophila_2:1629671_at:466:53; Interrogation_Position=343; Antisense; ATGCAACCAACGGTGGCAGCGTGTC
>probe:Drosophila_2:1629671_at:340:263; Interrogation_Position=359; Antisense; CAGCGTGTCAGGGAATCTCGATGGC
>probe:Drosophila_2:1629671_at:198:575; Interrogation_Position=381; Antisense; GGCGGCAATTCCAATGAGTCCCAAC
>probe:Drosophila_2:1629671_at:457:219; Interrogation_Position=393; Antisense; AATGAGTCCCAACCGTTGAACGTGC
>probe:Drosophila_2:1629671_at:722:613; Interrogation_Position=409; Antisense; TGAACGTGCCGCCTACGGATGCGCT
>probe:Drosophila_2:1629671_at:635:303; Interrogation_Position=434; Antisense; CCTGGTCCGCGGCAAAGCAATTGAG
>probe:Drosophila_2:1629671_at:507:117; Interrogation_Position=471; Antisense; AGCTATATGCTTGGTGACACGGTCT
>probe:Drosophila_2:1629671_at:204:141; Interrogation_Position=489; Antisense; ACGGTCTACTTCATTGTCACCTGGA
>probe:Drosophila_2:1629671_at:273:551; Interrogation_Position=548; Antisense; GGAGATCAAACATGTGCACCCCAAG
>probe:Drosophila_2:1629671_at:372:131; Interrogation_Position=565; Antisense; ACCCCAAGCTACTCATTGACTACAT
>probe:Drosophila_2:1629671_at:16:421; Interrogation_Position=652; Antisense; GAGCAGATCTCCAAATTGACTTTAT
>probe:Drosophila_2:1629671_at:636:403; Interrogation_Position=669; Antisense; GACTTTATCCATTATCATTATCCAT

Paste this into a BLAST search page for me
GAGTTCACAATTCGGCTCGGGCAGAGCTGCTCGTCGAGTTGTTGGTACAAATGCAACCAACGGTGGCAGCGTGTCCAGCGTGTCAGGGAATCTCGATGGCGGCGGCAATTCCAATGAGTCCCAACAATGAGTCCCAACCGTTGAACGTGCTGAACGTGCCGCCTACGGATGCGCTCCTGGTCCGCGGCAAAGCAATTGAGAGCTATATGCTTGGTGACACGGTCTACGGTCTACTTCATTGTCACCTGGAGGAGATCAAACATGTGCACCCCAAGACCCCAAGCTACTCATTGACTACATGAGCAGATCTCCAAATTGACTTTATGACTTTATCCATTATCATTATCCAT

Full Affymetrix probeset data:

Annotations for 1629671_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720