FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629672_at:

>probe:Drosophila_2:1629672_at:7:313; Interrogation_Position=102; Antisense; GCCAAAGTTTTTGAGCTCATGCTGT
>probe:Drosophila_2:1629672_at:508:69; Interrogation_Position=146; Antisense; AGGCCATCAATTCGTGTCGCAAGTC
>probe:Drosophila_2:1629672_at:721:635; Interrogation_Position=162; Antisense; TCGCAAGTCCTTGCTGGGCAATAAT
>probe:Drosophila_2:1629672_at:5:513; Interrogation_Position=19; Antisense; GTGTATAATCTGCTTTTCGTTGTAA
>probe:Drosophila_2:1629672_at:27:561; Interrogation_Position=204; Antisense; GGAAGTGCGCAATCTTAAGTCGGAT
>probe:Drosophila_2:1629672_at:19:623; Interrogation_Position=252; Antisense; TGCGGAGTGCTCCTTCAGGACCAAT
>probe:Drosophila_2:1629672_at:233:463; Interrogation_Position=278; Antisense; GATTCTTGTTGAGCAATGGCACTGT
>probe:Drosophila_2:1629672_at:719:141; Interrogation_Position=298; Antisense; ACTGTTAATACCCAGGCATTGCAGA
>probe:Drosophila_2:1629672_at:186:375; Interrogation_Position=375; Antisense; GAAGAGCCTCAATAGTTGCACGGAC
>probe:Drosophila_2:1629672_at:642:467; Interrogation_Position=389; Antisense; GTTGCACGGACTACGCTAGGAAGCG
>probe:Drosophila_2:1629672_at:39:223; Interrogation_Position=442; Antisense; AAGGGCGACTGCGACTTCTATCCTG
>probe:Drosophila_2:1629672_at:705:129; Interrogation_Position=469; Antisense; ACCTTGCTGGCCTGCGTCATGGAAA
>probe:Drosophila_2:1629672_at:496:387; Interrogation_Position=490; Antisense; GAAAAGGTCTACATCAACTGCCCGA
>probe:Drosophila_2:1629672_at:80:179; Interrogation_Position=528; Antisense; AAACACCAGCGATTGCACAGCGATG

Paste this into a BLAST search page for me
GCCAAAGTTTTTGAGCTCATGCTGTAGGCCATCAATTCGTGTCGCAAGTCTCGCAAGTCCTTGCTGGGCAATAATGTGTATAATCTGCTTTTCGTTGTAAGGAAGTGCGCAATCTTAAGTCGGATTGCGGAGTGCTCCTTCAGGACCAATGATTCTTGTTGAGCAATGGCACTGTACTGTTAATACCCAGGCATTGCAGAGAAGAGCCTCAATAGTTGCACGGACGTTGCACGGACTACGCTAGGAAGCGAAGGGCGACTGCGACTTCTATCCTGACCTTGCTGGCCTGCGTCATGGAAAGAAAAGGTCTACATCAACTGCCCGAAAACACCAGCGATTGCACAGCGATG

Full Affymetrix probeset data:

Annotations for 1629672_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720