FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629673_at:

>probe:Drosophila_2:1629673_at:548:191; Interrogation_Position=146; Antisense; AACTTAGAGAGATTGCCGCCATATG
>probe:Drosophila_2:1629673_at:528:191; Interrogation_Position=213; Antisense; AACTTTGGCTGGTGTTGCTATTGGT
>probe:Drosophila_2:1629673_at:604:719; Interrogation_Position=227; Antisense; TTGCTATTGGTTGTGGGCCTATCGT
>probe:Drosophila_2:1629673_at:580:637; Interrogation_Position=248; Antisense; TCGTTGGGTCTTCCGAGCTTGGAAA
>probe:Drosophila_2:1629673_at:426:399; Interrogation_Position=312; Antisense; GACAGCCAAAGGCACCTGGTTTGTG
>probe:Drosophila_2:1629673_at:505:29; Interrogation_Position=33; Antisense; ATAAGAACATTCTGTCACTGACGTT
>probe:Drosophila_2:1629673_at:706:495; Interrogation_Position=342; Antisense; GTCACCAGTTGCGATATGCCTACAA
>probe:Drosophila_2:1629673_at:479:103; Interrogation_Position=372; Antisense; AGACCGGAAACTGCGAGAGCTTCAT
>probe:Drosophila_2:1629673_at:488:425; Interrogation_Position=386; Antisense; GAGAGCTTCATCTACACGGGCTGTG
>probe:Drosophila_2:1629673_at:593:573; Interrogation_Position=404; Antisense; GGCTGTGCCTCCACTGAGAACAATT
>probe:Drosophila_2:1629673_at:479:423; Interrogation_Position=419; Antisense; GAGAACAATTTCCTGACCTTCGAGG
>probe:Drosophila_2:1629673_at:694:127; Interrogation_Position=434; Antisense; ACCTTCGAGGAGTGTCGCAGGGATT
>probe:Drosophila_2:1629673_at:25:543; Interrogation_Position=454; Antisense; GGATTGCATGCAACGTCTGCGCTAC
>probe:Drosophila_2:1629673_at:258:451; Interrogation_Position=64; Antisense; GATCGCAACGGAAAACTGAAGCTCT

Paste this into a BLAST search page for me
AACTTAGAGAGATTGCCGCCATATGAACTTTGGCTGGTGTTGCTATTGGTTTGCTATTGGTTGTGGGCCTATCGTTCGTTGGGTCTTCCGAGCTTGGAAAGACAGCCAAAGGCACCTGGTTTGTGATAAGAACATTCTGTCACTGACGTTGTCACCAGTTGCGATATGCCTACAAAGACCGGAAACTGCGAGAGCTTCATGAGAGCTTCATCTACACGGGCTGTGGGCTGTGCCTCCACTGAGAACAATTGAGAACAATTTCCTGACCTTCGAGGACCTTCGAGGAGTGTCGCAGGGATTGGATTGCATGCAACGTCTGCGCTACGATCGCAACGGAAAACTGAAGCTCT

Full Affymetrix probeset data:

Annotations for 1629673_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720