FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629675_at:

>probe:Drosophila_2:1629675_at:552:83; Interrogation_Position=283; Antisense; AGTGGCCTTTTGGATGATCGCCGAA
>probe:Drosophila_2:1629675_at:714:447; Interrogation_Position=298; Antisense; GATCGCCGAATTGAACTGACCATAC
>probe:Drosophila_2:1629675_at:34:663; Interrogation_Position=399; Antisense; TAACAGCACTTTGACGGCACTCGAA
>probe:Drosophila_2:1629675_at:385:25; Interrogation_Position=460; Antisense; ATAGTGAACATTTCCTCGGTGGCTG
>probe:Drosophila_2:1629675_at:164:607; Interrogation_Position=503; Antisense; TGATGGCCATATACTCCACTTCCAA
>probe:Drosophila_2:1629675_at:717:151; Interrogation_Position=529; Antisense; ACAGGTGTCACCACATTTACCAGGG
>probe:Drosophila_2:1629675_at:6:595; Interrogation_Position=590; Antisense; TGGGCTTCATTACCATCTGTCCAGG
>probe:Drosophila_2:1629675_at:144:597; Interrogation_Position=607; Antisense; TGTCCAGGCTACACGAATACCGGCA
>probe:Drosophila_2:1629675_at:322:241; Interrogation_Position=622; Antisense; AATACCGGCATTCTTAAGGACATTG
>probe:Drosophila_2:1629675_at:426:17; Interrogation_Position=666; Antisense; ATTTTATGAGACTCGCATGCGGACC
>probe:Drosophila_2:1629675_at:167:51; Interrogation_Position=682; Antisense; ATGCGGACCGTCTTCAGCAAGGTGA
>probe:Drosophila_2:1629675_at:492:337; Interrogation_Position=730; Antisense; GCTCGGAATATAGTCAACGCCATCG
>probe:Drosophila_2:1629675_at:610:377; Interrogation_Position=819; Antisense; GAACCTGTGGAATCCCCAGTTAGAT
>probe:Drosophila_2:1629675_at:670:443; Interrogation_Position=841; Antisense; GATGATTGCGTATTCGTCTGCTTGA

Paste this into a BLAST search page for me
AGTGGCCTTTTGGATGATCGCCGAAGATCGCCGAATTGAACTGACCATACTAACAGCACTTTGACGGCACTCGAAATAGTGAACATTTCCTCGGTGGCTGTGATGGCCATATACTCCACTTCCAAACAGGTGTCACCACATTTACCAGGGTGGGCTTCATTACCATCTGTCCAGGTGTCCAGGCTACACGAATACCGGCAAATACCGGCATTCTTAAGGACATTGATTTTATGAGACTCGCATGCGGACCATGCGGACCGTCTTCAGCAAGGTGAGCTCGGAATATAGTCAACGCCATCGGAACCTGTGGAATCCCCAGTTAGATGATGATTGCGTATTCGTCTGCTTGA

Full Affymetrix probeset data:

Annotations for 1629675_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720