FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629676_at:

>probe:Drosophila_2:1629676_at:243:441; Interrogation_Position=1067; Antisense; GATGGCTTCAGTTCCACTGCAGATA
>probe:Drosophila_2:1629676_at:470:45; Interrogation_Position=1113; Antisense; ATCGCGTAGACATTCTGGATCCTGC
>probe:Drosophila_2:1629676_at:408:335; Interrogation_Position=1146; Antisense; GCTCTGGTCGTCTGGATCGTAAGAT
>probe:Drosophila_2:1629676_at:94:43; Interrogation_Position=1161; Antisense; ATCGTAAGATCGAGTTCCCACATCC
>probe:Drosophila_2:1629676_at:149:439; Interrogation_Position=1190; Antisense; GAGGAAGCCCGTGCCCGTATTATGC
>probe:Drosophila_2:1629676_at:683:481; Interrogation_Position=1206; Antisense; GTATTATGCAGATTCACTCGCGTAA
>probe:Drosophila_2:1629676_at:189:245; Interrogation_Position=1253; Antisense; AATTTCGAGGAATTGTCCCGATCCA
>probe:Drosophila_2:1629676_at:80:447; Interrogation_Position=1272; Antisense; GATCCACGGATGACTTCAACGGCGC
>probe:Drosophila_2:1629676_at:424:377; Interrogation_Position=1319; Antisense; GAAGCTGGTATGATCGCACTGCGTC
>probe:Drosophila_2:1629676_at:353:353; Interrogation_Position=1363; Antisense; GCACGAAGACTTCATGGACGCCATC
>probe:Drosophila_2:1629676_at:116:699; Interrogation_Position=1451; Antisense; TTTAACTTCACATTGTCAGCTCCCA
>probe:Drosophila_2:1629676_at:58:93; Interrogation_Position=1508; Antisense; AGTTTCGATCTGAGTTGCCCCTTGA
>probe:Drosophila_2:1629676_at:634:623; Interrogation_Position=1523; Antisense; TGCCCCTTGAAGATCGCCTTTAAAA
>probe:Drosophila_2:1629676_at:18:31; Interrogation_Position=1547; Antisense; ATAACATCGCAACGGCTCTTAAAAG

Paste this into a BLAST search page for me
GATGGCTTCAGTTCCACTGCAGATAATCGCGTAGACATTCTGGATCCTGCGCTCTGGTCGTCTGGATCGTAAGATATCGTAAGATCGAGTTCCCACATCCGAGGAAGCCCGTGCCCGTATTATGCGTATTATGCAGATTCACTCGCGTAAAATTTCGAGGAATTGTCCCGATCCAGATCCACGGATGACTTCAACGGCGCGAAGCTGGTATGATCGCACTGCGTCGCACGAAGACTTCATGGACGCCATCTTTAACTTCACATTGTCAGCTCCCAAGTTTCGATCTGAGTTGCCCCTTGATGCCCCTTGAAGATCGCCTTTAAAAATAACATCGCAACGGCTCTTAAAAG

Full Affymetrix probeset data:

Annotations for 1629676_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720