Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629677_at:

>probe:Drosophila_2:1629677_at:673:317; Interrogation_Position=1279; Antisense; GCCGCTGCATTCCAGATTGGCAGAT
>probe:Drosophila_2:1629677_at:103:351; Interrogation_Position=1298; Antisense; GCAGATGCCACAGCTTGTTGCAGTT
>probe:Drosophila_2:1629677_at:534:283; Interrogation_Position=1361; Antisense; CTGCTGTTGAGCTTTTGGCGGGTCA
>probe:Drosophila_2:1629677_at:204:419; Interrogation_Position=1439; Antisense; GAGCAGTAGTAGACGGCCTTGCACT
>probe:Drosophila_2:1629677_at:660:485; Interrogation_Position=1476; Antisense; GTAGTTGCTGCTGAGTGCCGCAGAT
>probe:Drosophila_2:1629677_at:312:563; Interrogation_Position=1549; Antisense; GGAATGGCTTGCTGAATCCCTGACC
>probe:Drosophila_2:1629677_at:124:307; Interrogation_Position=1585; Antisense; CCTGCTCATTGCATTTTGCGGGAGA
>probe:Drosophila_2:1629677_at:520:413; Interrogation_Position=1613; Antisense; GAGCCAAAGGCGACGACCGATTTTA
>probe:Drosophila_2:1629677_at:262:127; Interrogation_Position=1628; Antisense; ACCGATTTTAACCTTGACAGCTCTC
>probe:Drosophila_2:1629677_at:253:159; Interrogation_Position=1703; Antisense; ACACACGCTCGCAGATTATGGCTAT
>probe:Drosophila_2:1629677_at:134:361; Interrogation_Position=1741; Antisense; GAATTACGGCACTCGGGCGTTTTAG
>probe:Drosophila_2:1629677_at:537:523; Interrogation_Position=1755; Antisense; GGGCGTTTTAGCCAACATTTCACTT
>probe:Drosophila_2:1629677_at:179:313; Interrogation_Position=1792; Antisense; GCTTATTTTAATCACGTAGGCCACC
>probe:Drosophila_2:1629677_at:522:679; Interrogation_Position=1808; Antisense; TAGGCCACCGAATTTGCCAAATAAA

Paste this into a BLAST search page for me
GCCGCTGCATTCCAGATTGGCAGATGCAGATGCCACAGCTTGTTGCAGTTCTGCTGTTGAGCTTTTGGCGGGTCAGAGCAGTAGTAGACGGCCTTGCACTGTAGTTGCTGCTGAGTGCCGCAGATGGAATGGCTTGCTGAATCCCTGACCCCTGCTCATTGCATTTTGCGGGAGAGAGCCAAAGGCGACGACCGATTTTAACCGATTTTAACCTTGACAGCTCTCACACACGCTCGCAGATTATGGCTATGAATTACGGCACTCGGGCGTTTTAGGGGCGTTTTAGCCAACATTTCACTTGCTTATTTTAATCACGTAGGCCACCTAGGCCACCGAATTTGCCAAATAAA

Full Affymetrix probeset data:

Annotations for 1629677_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime