FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629680_at:

>probe:Drosophila_2:1629680_at:213:125; Interrogation_Position=262; Antisense; AGCCCGCTGGGATTCATCATCAAGC
>probe:Drosophila_2:1629680_at:603:623; Interrogation_Position=314; Antisense; TGCGCGTCGAAGGTCCCAGTGGTCA
>probe:Drosophila_2:1629680_at:213:189; Interrogation_Position=359; Antisense; AACAGCAGTTGGATCCGGAGCGCTT
>probe:Drosophila_2:1629680_at:162:555; Interrogation_Position=375; Antisense; GGAGCGCTTTCAGATCGATTGCCAG
>probe:Drosophila_2:1629680_at:681:417; Interrogation_Position=410; Antisense; GAGCGGGTCTCTACAAGGTGCACAT
>probe:Drosophila_2:1629680_at:314:151; Interrogation_Position=431; Antisense; ACATCAAGTGCAATTCCGTGACCCT
>probe:Drosophila_2:1629680_at:676:35; Interrogation_Position=472; Antisense; ATCATCGTGGCCATCGCAGGAGCTA
>probe:Drosophila_2:1629680_at:343:75; Interrogation_Position=489; Antisense; AGGAGCTACCGAGTCCATCGATGGC
>probe:Drosophila_2:1629680_at:658:545; Interrogation_Position=549; Antisense; GGATGCCAGCCGAGTACAGAGCCGT
>probe:Drosophila_2:1629680_at:591:261; Interrogation_Position=594; Antisense; CAGCTTGGTGGAGCGCAACGAGTTC
>probe:Drosophila_2:1629680_at:692:69; Interrogation_Position=635; Antisense; AGGCGGGTAGCAACATGCTCCTGGT
>probe:Drosophila_2:1629680_at:560:591; Interrogation_Position=710; Antisense; TGGGACGCGGCATACACAGGGTCAC
>probe:Drosophila_2:1629680_at:563:45; Interrogation_Position=749; Antisense; ATCCCGGTGACTACATCCTGGTGGT
>probe:Drosophila_2:1629680_at:260:447; Interrogation_Position=800; Antisense; GATCCCCGTTCAGCTTAAGTGCGGA

Paste this into a BLAST search page for me
AGCCCGCTGGGATTCATCATCAAGCTGCGCGTCGAAGGTCCCAGTGGTCAAACAGCAGTTGGATCCGGAGCGCTTGGAGCGCTTTCAGATCGATTGCCAGGAGCGGGTCTCTACAAGGTGCACATACATCAAGTGCAATTCCGTGACCCTATCATCGTGGCCATCGCAGGAGCTAAGGAGCTACCGAGTCCATCGATGGCGGATGCCAGCCGAGTACAGAGCCGTCAGCTTGGTGGAGCGCAACGAGTTCAGGCGGGTAGCAACATGCTCCTGGTTGGGACGCGGCATACACAGGGTCACATCCCGGTGACTACATCCTGGTGGTGATCCCCGTTCAGCTTAAGTGCGGA

Full Affymetrix probeset data:

Annotations for 1629680_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720