FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629682_at:

>probe:Drosophila_2:1629682_at:351:11; Interrogation_Position=105; Antisense; ATTCGAATGCCGTTTGGAGTGGCAG
>probe:Drosophila_2:1629682_at:462:585; Interrogation_Position=149; Antisense; TGGAGCTGAAGCTGGTGCTGGTGCT
>probe:Drosophila_2:1629682_at:658:285; Interrogation_Position=184; Antisense; CTGGAGCAGTGGCTGTTTGGAGCTG
>probe:Drosophila_2:1629682_at:184:729; Interrogation_Position=200; Antisense; TTGGAGCTGCTGGTCGTCAGGTCAT
>probe:Drosophila_2:1629682_at:601:333; Interrogation_Position=208; Antisense; GCTGGTCGTCAGGTCATGTGCAATT
>probe:Drosophila_2:1629682_at:618:125; Interrogation_Position=21; Antisense; ACCAAGCACTGTCCATCAATCGGAG
>probe:Drosophila_2:1629682_at:31:537; Interrogation_Position=211; Antisense; GGTCGTCAGGTCATGTGCAATTTAT
>probe:Drosophila_2:1629682_at:205:113; Interrogation_Position=25; Antisense; AGCACTGTCCATCAATCGGAGGAGG
>probe:Drosophila_2:1629682_at:286:549; Interrogation_Position=63; Antisense; GGAGGCTGGGCATGCTACAGTCCAT
>probe:Drosophila_2:1629682_at:34:595; Interrogation_Position=69; Antisense; TGGGCATGCTACAGTCCATCTGGGA
>probe:Drosophila_2:1629682_at:359:49; Interrogation_Position=74; Antisense; ATGCTACAGTCCATCTGGGAGCGGG
>probe:Drosophila_2:1629682_at:416:87; Interrogation_Position=81; Antisense; AGTCCATCTGGGAGCGGGATCCACA
>probe:Drosophila_2:1629682_at:558:553; Interrogation_Position=91; Antisense; GGAGCGGGATCCACATTCGAATGCC
>probe:Drosophila_2:1629682_at:118:547; Interrogation_Position=97; Antisense; GGATCCACATTCGAATGCCGTTTGG

Paste this into a BLAST search page for me
ATTCGAATGCCGTTTGGAGTGGCAGTGGAGCTGAAGCTGGTGCTGGTGCTCTGGAGCAGTGGCTGTTTGGAGCTGTTGGAGCTGCTGGTCGTCAGGTCATGCTGGTCGTCAGGTCATGTGCAATTACCAAGCACTGTCCATCAATCGGAGGGTCGTCAGGTCATGTGCAATTTATAGCACTGTCCATCAATCGGAGGAGGGGAGGCTGGGCATGCTACAGTCCATTGGGCATGCTACAGTCCATCTGGGAATGCTACAGTCCATCTGGGAGCGGGAGTCCATCTGGGAGCGGGATCCACAGGAGCGGGATCCACATTCGAATGCCGGATCCACATTCGAATGCCGTTTGG

Full Affymetrix probeset data:

Annotations for 1629682_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720