FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629683_at:

>probe:Drosophila_2:1629683_at:584:681; Interrogation_Position=2708; Antisense; TATGTGTGCGAGTTTTGCCACCGGC
>probe:Drosophila_2:1629683_at:480:121; Interrogation_Position=2789; Antisense; AGCGGCATGCTGAAGCGGCTGCTTA
>probe:Drosophila_2:1629683_at:489:335; Interrogation_Position=2806; Antisense; GCTGCTTAAGACGACCGCCATCAAG
>probe:Drosophila_2:1629683_at:361:45; Interrogation_Position=2904; Antisense; ATCCGCGCACTAGTCTGTATGACTT
>probe:Drosophila_2:1629683_at:366:601; Interrogation_Position=2919; Antisense; TGTATGACTTCACCAGCGAGCTGGG
>probe:Drosophila_2:1629683_at:683:311; Interrogation_Position=2950; Antisense; GCCACCGGGCATCCAATAGGAGCTA
>probe:Drosophila_2:1629683_at:365:465; Interrogation_Position=2976; Antisense; GTTGGAACGCCATCTTTTAGAGAAC
>probe:Drosophila_2:1629683_at:326:267; Interrogation_Position=3023; Antisense; CAGTCAGTCCATCCATCGGTTGGAT
>probe:Drosophila_2:1629683_at:57:57; Interrogation_Position=3046; Antisense; ATGACCAGTGAGAAGCAGCAGCCAA
>probe:Drosophila_2:1629683_at:596:241; Interrogation_Position=3082; Antisense; AATACTTTGCCCATTGTTTTCGCAC
>probe:Drosophila_2:1629683_at:194:3; Interrogation_Position=3094; Antisense; ATTGTTTTCGCACTGGACCGACGAT
>probe:Drosophila_2:1629683_at:217:453; Interrogation_Position=3167; Antisense; GATCTCCAGCGTGAACTAGGTCTTA
>probe:Drosophila_2:1629683_at:394:679; Interrogation_Position=3214; Antisense; TAGGCATATTTTGGCGTCAACTGTT
>probe:Drosophila_2:1629683_at:244:283; Interrogation_Position=3234; Antisense; CTGTTTTATTACTCTTATCCCTATG

Paste this into a BLAST search page for me
TATGTGTGCGAGTTTTGCCACCGGCAGCGGCATGCTGAAGCGGCTGCTTAGCTGCTTAAGACGACCGCCATCAAGATCCGCGCACTAGTCTGTATGACTTTGTATGACTTCACCAGCGAGCTGGGGCCACCGGGCATCCAATAGGAGCTAGTTGGAACGCCATCTTTTAGAGAACCAGTCAGTCCATCCATCGGTTGGATATGACCAGTGAGAAGCAGCAGCCAAAATACTTTGCCCATTGTTTTCGCACATTGTTTTCGCACTGGACCGACGATGATCTCCAGCGTGAACTAGGTCTTATAGGCATATTTTGGCGTCAACTGTTCTGTTTTATTACTCTTATCCCTATG

Full Affymetrix probeset data:

Annotations for 1629683_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720