FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629685_at:

>probe:Drosophila_2:1629685_at:531:441; Interrogation_Position=124; Antisense; GATGGAGCCTGCACTGCTGAGCTAA
>probe:Drosophila_2:1629685_at:418:489; Interrogation_Position=174; Antisense; GTACAAGTTTTTGCACGGCGGTTAT
>probe:Drosophila_2:1629685_at:81:541; Interrogation_Position=193; Antisense; GGTTATATCATGACCCTGGTGGACT
>probe:Drosophila_2:1629685_at:81:725; Interrogation_Position=217; Antisense; TTGATAACCACCTACGCCCTAATGT
>probe:Drosophila_2:1629685_at:273:657; Interrogation_Position=236; Antisense; TAATGTCCAAGCCATGTCATCCCGG
>probe:Drosophila_2:1629685_at:393:497; Interrogation_Position=251; Antisense; GTCATCCCGGAGTTTCGGTAGATCT
>probe:Drosophila_2:1629685_at:619:195; Interrogation_Position=302; Antisense; AACTGGGCGACGATGTGGTGATTCA
>probe:Drosophila_2:1629685_at:662:533; Interrogation_Position=318; Antisense; GGTGATTCAGGCCAATCTGTCCAAG
>probe:Drosophila_2:1629685_at:593:145; Interrogation_Position=33; Antisense; ACTCGAATTCGCTAAACACATCACC
>probe:Drosophila_2:1629685_at:643:217; Interrogation_Position=349; Antisense; AAGTACCTTGCCTTCATCGATTGCA
>probe:Drosophila_2:1629685_at:276:43; Interrogation_Position=364; Antisense; ATCGATTGCACCCTGAAGCACAAGA
>probe:Drosophila_2:1629685_at:5:127; Interrogation_Position=405; Antisense; AGCCAAGGGCACACATCTAAAGTAT
>probe:Drosophila_2:1629685_at:666:461; Interrogation_Position=60; Antisense; GATTATCAACAAGTCAACGGGCTTT
>probe:Drosophila_2:1629685_at:390:287; Interrogation_Position=77; Antisense; CGGGCTTTGAAAGTCACCTACAGAA

Paste this into a BLAST search page for me
GATGGAGCCTGCACTGCTGAGCTAAGTACAAGTTTTTGCACGGCGGTTATGGTTATATCATGACCCTGGTGGACTTTGATAACCACCTACGCCCTAATGTTAATGTCCAAGCCATGTCATCCCGGGTCATCCCGGAGTTTCGGTAGATCTAACTGGGCGACGATGTGGTGATTCAGGTGATTCAGGCCAATCTGTCCAAGACTCGAATTCGCTAAACACATCACCAAGTACCTTGCCTTCATCGATTGCAATCGATTGCACCCTGAAGCACAAGAAGCCAAGGGCACACATCTAAAGTATGATTATCAACAAGTCAACGGGCTTTCGGGCTTTGAAAGTCACCTACAGAA

Full Affymetrix probeset data:

Annotations for 1629685_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720