FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629688_at:

>probe:Drosophila_2:1629688_at:79:447; Interrogation_Position=3539; Antisense; GATCCGGAGGACACCACTGGCGATA
>probe:Drosophila_2:1629688_at:504:519; Interrogation_Position=3566; Antisense; GTGGATTGCTATTCCTGCGGAGTGC
>probe:Drosophila_2:1629688_at:18:623; Interrogation_Position=3581; Antisense; TGCGGAGTGCCCGTGCCAGATAGCT
>probe:Drosophila_2:1629688_at:630:649; Interrogation_Position=3666; Antisense; TCACCCAGCCGACGAACAACATATG
>probe:Drosophila_2:1629688_at:365:249; Interrogation_Position=3682; Antisense; CAACATATGGATCTGTACCACCTGC
>probe:Drosophila_2:1629688_at:572:597; Interrogation_Position=3756; Antisense; TGTGCCACAGTTTGATCGTGTCCAT
>probe:Drosophila_2:1629688_at:629:41; Interrogation_Position=3770; Antisense; ATCGTGTCCATGACGGTGGAGATCT
>probe:Drosophila_2:1629688_at:245:557; Interrogation_Position=3806; Antisense; GGACTAGTGTTTTAATTACTCCAGC
>probe:Drosophila_2:1629688_at:440:707; Interrogation_Position=3821; Antisense; TTACTCCAGCTGTTTTTCATTCTGC
>probe:Drosophila_2:1629688_at:274:683; Interrogation_Position=3847; Antisense; TATCCCAGGTGGTACAGGCGTATCT
>probe:Drosophila_2:1629688_at:302:153; Interrogation_Position=3860; Antisense; ACAGGCGTATCTACTCCGCAAATAA
>probe:Drosophila_2:1629688_at:153:405; Interrogation_Position=3951; Antisense; GACTGTTCACAGTGAGTATTTCCTG
>probe:Drosophila_2:1629688_at:60:529; Interrogation_Position=3976; Antisense; GGGAGTGCGCTAGGGCCACACTACT
>probe:Drosophila_2:1629688_at:698:187; Interrogation_Position=4010; Antisense; AACACTCGCAAAGCGGTCACACTGG

Paste this into a BLAST search page for me
GATCCGGAGGACACCACTGGCGATAGTGGATTGCTATTCCTGCGGAGTGCTGCGGAGTGCCCGTGCCAGATAGCTTCACCCAGCCGACGAACAACATATGCAACATATGGATCTGTACCACCTGCTGTGCCACAGTTTGATCGTGTCCATATCGTGTCCATGACGGTGGAGATCTGGACTAGTGTTTTAATTACTCCAGCTTACTCCAGCTGTTTTTCATTCTGCTATCCCAGGTGGTACAGGCGTATCTACAGGCGTATCTACTCCGCAAATAAGACTGTTCACAGTGAGTATTTCCTGGGGAGTGCGCTAGGGCCACACTACTAACACTCGCAAAGCGGTCACACTGG

Full Affymetrix probeset data:

Annotations for 1629688_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720