FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629690_at:

>probe:Drosophila_2:1629690_at:553:577; Interrogation_Position=3767; Antisense; GGCCTACATCCGTTGCAAACTATGC
>probe:Drosophila_2:1629690_at:403:147; Interrogation_Position=3785; Antisense; ACTATGCAAGCAGAGCAGTGCGGAC
>probe:Drosophila_2:1629690_at:652:591; Interrogation_Position=3823; Antisense; TGGGTGAGTTGCACAGCCTCCGCGA
>probe:Drosophila_2:1629690_at:32:113; Interrogation_Position=3856; Antisense; AGCACATTCGTAAACACCATCCAGG
>probe:Drosophila_2:1629690_at:475:529; Interrogation_Position=3886; Antisense; GGGATGCCGAGATGATATCACTAAT
>probe:Drosophila_2:1629690_at:524:175; Interrogation_Position=3974; Antisense; AAACCCTACTGGTCAGGACTCAGGA
>probe:Drosophila_2:1629690_at:329:557; Interrogation_Position=3989; Antisense; GGACTCAGGACCGTATATGCCGCTG
>probe:Drosophila_2:1629690_at:667:625; Interrogation_Position=4012; Antisense; TGCCGCCACATCTTTTGGACGATGA
>probe:Drosophila_2:1629690_at:545:33; Interrogation_Position=4057; Antisense; ATCAGTATCTGCTCGGCTAGTATTA
>probe:Drosophila_2:1629690_at:336:61; Interrogation_Position=4119; Antisense; ATGTAATCTTTCCATCATGCACGTC
>probe:Drosophila_2:1629690_at:623:433; Interrogation_Position=4173; Antisense; GAGTGTATTCGATTTGCATATTGTA
>probe:Drosophila_2:1629690_at:330:79; Interrogation_Position=4204; Antisense; AGTGTCTTTTACTGAAACCATGAAA
>probe:Drosophila_2:1629690_at:174:11; Interrogation_Position=4293; Antisense; ATTACGTTTTGCCACTAAGCTAGCC
>probe:Drosophila_2:1629690_at:371:659; Interrogation_Position=4308; Antisense; TAAGCTAGCCCGTTTTTATGACCCA

Paste this into a BLAST search page for me
GGCCTACATCCGTTGCAAACTATGCACTATGCAAGCAGAGCAGTGCGGACTGGGTGAGTTGCACAGCCTCCGCGAAGCACATTCGTAAACACCATCCAGGGGGATGCCGAGATGATATCACTAATAAACCCTACTGGTCAGGACTCAGGAGGACTCAGGACCGTATATGCCGCTGTGCCGCCACATCTTTTGGACGATGAATCAGTATCTGCTCGGCTAGTATTAATGTAATCTTTCCATCATGCACGTCGAGTGTATTCGATTTGCATATTGTAAGTGTCTTTTACTGAAACCATGAAAATTACGTTTTGCCACTAAGCTAGCCTAAGCTAGCCCGTTTTTATGACCCA

Full Affymetrix probeset data:

Annotations for 1629690_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720