FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629691_at:

>probe:Drosophila_2:1629691_at:286:41; Interrogation_Position=1005; Antisense; ATCGTGTCCAATGTTCTTTGCGGTT
>probe:Drosophila_2:1629691_at:726:417; Interrogation_Position=1039; Antisense; GAGCTGGCCTCATATCCGGCAGGAA
>probe:Drosophila_2:1629691_at:154:561; Interrogation_Position=1060; Antisense; GGAACTACGGTGACCATTACGCCAT
>probe:Drosophila_2:1629691_at:187:563; Interrogation_Position=1110; Antisense; GGAACCGCCATTGCCGGCAAGAATA
>probe:Drosophila_2:1629691_at:541:579; Interrogation_Position=1148; Antisense; GGCCATGATCAGTGCCAGTATCGAT
>probe:Drosophila_2:1629691_at:444:593; Interrogation_Position=1186; Antisense; TGGGCCACAAGGAGCACGCCAATGT
>probe:Drosophila_2:1629691_at:606:229; Interrogation_Position=1206; Antisense; AATGTCATTCAGGAGGCCGTCTACC
>probe:Drosophila_2:1629691_at:478:49; Interrogation_Position=1246; Antisense; ATGCCATTCGCACGCCAGATATTGG
>probe:Drosophila_2:1629691_at:719:243; Interrogation_Position=1364; Antisense; AATTTAGGCACTATCGCACTACCGA
>probe:Drosophila_2:1629691_at:450:65; Interrogation_Position=856; Antisense; ATGGTCTCTTCCTGGAGGTTGCCAA
>probe:Drosophila_2:1629691_at:609:77; Interrogation_Position=871; Antisense; AGGTTGCCAACCGTGTGCACAAGGA
>probe:Drosophila_2:1629691_at:192:75; Interrogation_Position=892; Antisense; AGGACTATCCCGAACTGGAGCACAA
>probe:Drosophila_2:1629691_at:276:605; Interrogation_Position=922; Antisense; TGATTATCGACAACACCTGCATGCA
>probe:Drosophila_2:1629691_at:700:151; Interrogation_Position=982; Antisense; ACATGACCAATCTGTACGGCACCAT

Paste this into a BLAST search page for me
ATCGTGTCCAATGTTCTTTGCGGTTGAGCTGGCCTCATATCCGGCAGGAAGGAACTACGGTGACCATTACGCCATGGAACCGCCATTGCCGGCAAGAATAGGCCATGATCAGTGCCAGTATCGATTGGGCCACAAGGAGCACGCCAATGTAATGTCATTCAGGAGGCCGTCTACCATGCCATTCGCACGCCAGATATTGGAATTTAGGCACTATCGCACTACCGAATGGTCTCTTCCTGGAGGTTGCCAAAGGTTGCCAACCGTGTGCACAAGGAAGGACTATCCCGAACTGGAGCACAATGATTATCGACAACACCTGCATGCAACATGACCAATCTGTACGGCACCAT

Full Affymetrix probeset data:

Annotations for 1629691_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720