FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629692_at:

>probe:Drosophila_2:1629692_at:142:531; Interrogation_Position=122; Antisense; GGGTGAAATCCGCAGAGTACTACAA
>probe:Drosophila_2:1629692_at:216:487; Interrogation_Position=138; Antisense; GTACTACAAACTGGCCTTGAAGGCA
>probe:Drosophila_2:1629692_at:614:273; Interrogation_Position=153; Antisense; CTTGAAGGCACTGCGGAGCCATCGA
>probe:Drosophila_2:1629692_at:720:417; Interrogation_Position=179; Antisense; GAGCAGTTGGTCTCCTGGGTGAACC
>probe:Drosophila_2:1629692_at:639:583; Interrogation_Position=18; Antisense; TGGACTCAAGTTTCCGTCGAACCGA
>probe:Drosophila_2:1629692_at:404:511; Interrogation_Position=197; Antisense; GTGAACCCATCAAGGACTCTGGCAT
>probe:Drosophila_2:1629692_at:293:727; Interrogation_Position=315; Antisense; TTGGGCGTCCAATCAGCCGGATAGA
>probe:Drosophila_2:1629692_at:389:451; Interrogation_Position=348; Antisense; GATCGATCGACTGGAGCTGGAAACA
>probe:Drosophila_2:1629692_at:101:661; Interrogation_Position=419; Antisense; TAACCTTCGATCTGCCCGAGAGTAT
>probe:Drosophila_2:1629692_at:231:145; Interrogation_Position=454; Antisense; ACTGCCCAGCAAGTTGATTCCAATG
>probe:Drosophila_2:1629692_at:134:465; Interrogation_Position=469; Antisense; GATTCCAATGTCATTCTATCCGCAT
>probe:Drosophila_2:1629692_at:725:43; Interrogation_Position=486; Antisense; ATCCGCATCGGATCAACAACCAGAA
>probe:Drosophila_2:1629692_at:566:21; Interrogation_Position=53; Antisense; ATATTTGTGTCTACGGTGCGGTGGC
>probe:Drosophila_2:1629692_at:545:581; Interrogation_Position=74; Antisense; TGGCCTCCATATCCGCTGTGATGTA

Paste this into a BLAST search page for me
GGGTGAAATCCGCAGAGTACTACAAGTACTACAAACTGGCCTTGAAGGCACTTGAAGGCACTGCGGAGCCATCGAGAGCAGTTGGTCTCCTGGGTGAACCTGGACTCAAGTTTCCGTCGAACCGAGTGAACCCATCAAGGACTCTGGCATTTGGGCGTCCAATCAGCCGGATAGAGATCGATCGACTGGAGCTGGAAACATAACCTTCGATCTGCCCGAGAGTATACTGCCCAGCAAGTTGATTCCAATGGATTCCAATGTCATTCTATCCGCATATCCGCATCGGATCAACAACCAGAAATATTTGTGTCTACGGTGCGGTGGCTGGCCTCCATATCCGCTGTGATGTA

Full Affymetrix probeset data:

Annotations for 1629692_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720