Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629693_at:

>probe:Drosophila_2:1629693_at:655:417; Interrogation_Position=4969; Antisense; GAGCATGTGGTGTACGCCACGTCCA
>probe:Drosophila_2:1629693_at:545:369; Interrogation_Position=4998; Antisense; GACCAAAGTCACCTCCGAAACGGAG
>probe:Drosophila_2:1629693_at:498:141; Interrogation_Position=5017; Antisense; ACGGAGATCTGCTACCGCGGACGAT
>probe:Drosophila_2:1629693_at:326:409; Interrogation_Position=5036; Antisense; GACGATGCATCCGTTCCGAAGATCT
>probe:Drosophila_2:1629693_at:294:33; Interrogation_Position=5069; Antisense; ATCACAAACTGCACTGAGCACACTC
>probe:Drosophila_2:1629693_at:529:259; Interrogation_Position=5089; Antisense; CACTCCTCCGGCAGCGGAAATTGAA
>probe:Drosophila_2:1629693_at:505:303; Interrogation_Position=5188; Antisense; CCTCCAGCTGCATTGGCCCAAAATA
>probe:Drosophila_2:1629693_at:434:201; Interrogation_Position=5216; Antisense; AACCGTATCCGCTGTAATTACTTAG
>probe:Drosophila_2:1629693_at:484:673; Interrogation_Position=5383; Antisense; TACCTGCATTGAGCGCTCTTTTGAA
>probe:Drosophila_2:1629693_at:126:389; Interrogation_Position=5405; Antisense; GAAAACCCTTGATATTTCCAGTTAG
>probe:Drosophila_2:1629693_at:50:101; Interrogation_Position=5451; Antisense; AGAGATAGCATTACGTCAGGATACC
>probe:Drosophila_2:1629693_at:54:293; Interrogation_Position=5464; Antisense; CGTCAGGATACCACATAGCCAGCAT
>probe:Drosophila_2:1629693_at:125:675; Interrogation_Position=5479; Antisense; TAGCCAGCATATAAGTCTACCATAT
>probe:Drosophila_2:1629693_at:65:499; Interrogation_Position=5493; Antisense; GTCTACCATATGTACATCATTGTGT

Paste this into a BLAST search page for me
GAGCATGTGGTGTACGCCACGTCCAGACCAAAGTCACCTCCGAAACGGAGACGGAGATCTGCTACCGCGGACGATGACGATGCATCCGTTCCGAAGATCTATCACAAACTGCACTGAGCACACTCCACTCCTCCGGCAGCGGAAATTGAACCTCCAGCTGCATTGGCCCAAAATAAACCGTATCCGCTGTAATTACTTAGTACCTGCATTGAGCGCTCTTTTGAAGAAAACCCTTGATATTTCCAGTTAGAGAGATAGCATTACGTCAGGATACCCGTCAGGATACCACATAGCCAGCATTAGCCAGCATATAAGTCTACCATATGTCTACCATATGTACATCATTGTGT

Full Affymetrix probeset data:

Annotations for 1629693_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime