Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629695_at:

>probe:Drosophila_2:1629695_at:504:429; Interrogation_Position=1068; Antisense; GAGTTACTATATCCGCTTTTAGCCA
>probe:Drosophila_2:1629695_at:181:475; Interrogation_Position=1146; Antisense; GTTAAATGCGTACAATCTCTTAGTG
>probe:Drosophila_2:1629695_at:545:627; Interrogation_Position=587; Antisense; TGCCATTACCACTTCATTCGGCTGG
>probe:Drosophila_2:1629695_at:634:697; Interrogation_Position=638; Antisense; TTTATGGGCGCCTACTGCAAGTACG
>probe:Drosophila_2:1629695_at:570:275; Interrogation_Position=649; Antisense; CTACTGCAAGTACGTCCTGAAGGAC
>probe:Drosophila_2:1629695_at:586:405; Interrogation_Position=698; Antisense; GACTCGCAGGCCTTTGCTGATGTGG
>probe:Drosophila_2:1629695_at:275:683; Interrogation_Position=779; Antisense; TATCCCGTATTCACTGGCACTTTGA
>probe:Drosophila_2:1629695_at:178:143; Interrogation_Position=791; Antisense; ACTGGCACTTTGATGATTACGGGCA
>probe:Drosophila_2:1629695_at:652:139; Interrogation_Position=809; Antisense; ACGGGCATGATGCTTTTCAGCGGCT
>probe:Drosophila_2:1629695_at:628:701; Interrogation_Position=822; Antisense; TTTTCAGCGGCTGCATGTACTACCG
>probe:Drosophila_2:1629695_at:633:147; Interrogation_Position=840; Antisense; ACTACCGCGCTTTGACTGGCGAGAA
>probe:Drosophila_2:1629695_at:109:583; Interrogation_Position=856; Antisense; TGGCGAGAAGCGTCTGCAACCGTAC
>probe:Drosophila_2:1629695_at:708:69; Interrogation_Position=947; Antisense; AGGCCACCTATCTATATTCCATGTA
>probe:Drosophila_2:1629695_at:285:601; Interrogation_Position=968; Antisense; TGTAGCACATGCTGAACTGCAATTT

Paste this into a BLAST search page for me
GAGTTACTATATCCGCTTTTAGCCAGTTAAATGCGTACAATCTCTTAGTGTGCCATTACCACTTCATTCGGCTGGTTTATGGGCGCCTACTGCAAGTACGCTACTGCAAGTACGTCCTGAAGGACGACTCGCAGGCCTTTGCTGATGTGGTATCCCGTATTCACTGGCACTTTGAACTGGCACTTTGATGATTACGGGCAACGGGCATGATGCTTTTCAGCGGCTTTTTCAGCGGCTGCATGTACTACCGACTACCGCGCTTTGACTGGCGAGAATGGCGAGAAGCGTCTGCAACCGTACAGGCCACCTATCTATATTCCATGTATGTAGCACATGCTGAACTGCAATTT

Full Affymetrix probeset data:

Annotations for 1629695_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime