Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629697_a_at:

>probe:Drosophila_2:1629697_a_at:674:119; Interrogation_Position=359; Antisense; AGCTGATGAGCGTGTTCTTGCCCCA
>probe:Drosophila_2:1629697_a_at:344:319; Interrogation_Position=393; Antisense; GCCCACCATTAAGTTTCGCAAGCGA
>probe:Drosophila_2:1629697_a_at:507:325; Interrogation_Position=434; Antisense; GCGAGAAACTTTTCGCCCTGTGCAA
>probe:Drosophila_2:1629697_a_at:272:301; Interrogation_Position=481; Antisense; CCGCACATCACGTGGCTAATCAATG
>probe:Drosophila_2:1629697_a_at:63:589; Interrogation_Position=515; Antisense; TGGAGGACAGGTACGTGCGCACCCA
>probe:Drosophila_2:1629697_a_at:331:719; Interrogation_Position=637; Antisense; TTCCAGCAGCAGTACTTCAACCAGT
>probe:Drosophila_2:1629697_a_at:664:275; Interrogation_Position=651; Antisense; CTTCAACCAGTACCATCAGCAGTAT
>probe:Drosophila_2:1629697_a_at:148:467; Interrogation_Position=685; Antisense; GTTGGCCAATTCATGGATCGCTACG
>probe:Drosophila_2:1629697_a_at:187:175; Interrogation_Position=713; Antisense; AAAGCCTACGATGGCCAGCAGGAGC
>probe:Drosophila_2:1629697_a_at:100:53; Interrogation_Position=746; Antisense; ATGAGTTCCCGCACTTTTTGTCGCA
>probe:Drosophila_2:1629697_a_at:43:497; Interrogation_Position=788; Antisense; GTCACCACGGTAGCCTGTACAACAA
>probe:Drosophila_2:1629697_a_at:321:185; Interrogation_Position=808; Antisense; AACAATCCGTTTGGATCGCTGGCCA
>probe:Drosophila_2:1629697_a_at:290:147; Interrogation_Position=833; Antisense; ACTACCATGACGTGGGCGAGTTCCA
>probe:Drosophila_2:1629697_a_at:362:535; Interrogation_Position=861; Antisense; GGTGCATCAGCGCAACTACGACAGC

Paste this into a BLAST search page for me
AGCTGATGAGCGTGTTCTTGCCCCAGCCCACCATTAAGTTTCGCAAGCGAGCGAGAAACTTTTCGCCCTGTGCAACCGCACATCACGTGGCTAATCAATGTGGAGGACAGGTACGTGCGCACCCATTCCAGCAGCAGTACTTCAACCAGTCTTCAACCAGTACCATCAGCAGTATGTTGGCCAATTCATGGATCGCTACGAAAGCCTACGATGGCCAGCAGGAGCATGAGTTCCCGCACTTTTTGTCGCAGTCACCACGGTAGCCTGTACAACAAAACAATCCGTTTGGATCGCTGGCCAACTACCATGACGTGGGCGAGTTCCAGGTGCATCAGCGCAACTACGACAGC

Full Affymetrix probeset data:

Annotations for 1629697_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime