FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629698_at:

>probe:Drosophila_2:1629698_at:368:135; Interrogation_Position=1014; Antisense; ACGAATCGTGTTCTGGATGCCCATG
>probe:Drosophila_2:1629698_at:92:569; Interrogation_Position=1078; Antisense; GGCGAAACTATCTCCTTTACGGACG
>probe:Drosophila_2:1629698_at:345:59; Interrogation_Position=1118; Antisense; AGGCTGTCAAGGCTCCTAGGACGAT
>probe:Drosophila_2:1629698_at:683:241; Interrogation_Position=1221; Antisense; AATAGTTGATCTCACCAATGCCCTA
>probe:Drosophila_2:1629698_at:219:169; Interrogation_Position=1317; Antisense; AAAGGCACGGGTTGTTCATCAGCTG
>probe:Drosophila_2:1629698_at:187:171; Interrogation_Position=1353; Antisense; AAAGTTTGCAGACCAACTCGCAGCT
>probe:Drosophila_2:1629698_at:517:287; Interrogation_Position=1396; Antisense; CTGGCCAGTCCTTATGCTTTTGAGA
>probe:Drosophila_2:1629698_at:110:121; Interrogation_Position=1454; Antisense; AGCTGGCTGCGTTCGACTCCGAAAA
>probe:Drosophila_2:1629698_at:249:471; Interrogation_Position=1482; Antisense; GTTCCTGGTGTGGTGTGCAAACTTT
>probe:Drosophila_2:1629698_at:300:147; Interrogation_Position=1502; Antisense; ACTTTTGGCCAAGTTTCGGCTGTGT
>probe:Drosophila_2:1629698_at:487:573; Interrogation_Position=1519; Antisense; GGCTGTGTGTATATGTTCTCCTGCA
>probe:Drosophila_2:1629698_at:620:241; Interrogation_Position=949; Antisense; AATATGGGTCCTGTTCGATGCATGC
>probe:Drosophila_2:1629698_at:564:445; Interrogation_Position=965; Antisense; GATGCATGCGCTTCAATCCGAGAGC
>probe:Drosophila_2:1629698_at:484:415; Interrogation_Position=986; Antisense; GAGCCACCATGTTCGTGAGCAGCGA

Paste this into a BLAST search page for me
ACGAATCGTGTTCTGGATGCCCATGGGCGAAACTATCTCCTTTACGGACGAGGCTGTCAAGGCTCCTAGGACGATAATAGTTGATCTCACCAATGCCCTAAAAGGCACGGGTTGTTCATCAGCTGAAAGTTTGCAGACCAACTCGCAGCTCTGGCCAGTCCTTATGCTTTTGAGAAGCTGGCTGCGTTCGACTCCGAAAAGTTCCTGGTGTGGTGTGCAAACTTTACTTTTGGCCAAGTTTCGGCTGTGTGGCTGTGTGTATATGTTCTCCTGCAAATATGGGTCCTGTTCGATGCATGCGATGCATGCGCTTCAATCCGAGAGCGAGCCACCATGTTCGTGAGCAGCGA

Full Affymetrix probeset data:

Annotations for 1629698_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720