FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629701_at:

>probe:Drosophila_2:1629701_at:542:659; Interrogation_Position=1004; Antisense; TAAGCTATCGTGATCCCATGGAGTT
>probe:Drosophila_2:1629701_at:450:425; Interrogation_Position=1035; Antisense; GAGAGTGGTGAGTCACGCCCGCTAC
>probe:Drosophila_2:1629701_at:615:75; Interrogation_Position=1082; Antisense; AGGAGTACTGTGTCCACGGATTTCC
>probe:Drosophila_2:1629701_at:607:573; Interrogation_Position=1108; Antisense; GGCGGAGCCATTAACTTTAGCATCA
>probe:Drosophila_2:1629701_at:30:707; Interrogation_Position=1124; Antisense; TTAGCATCAGTTTCAAGCCTCTGCC
>probe:Drosophila_2:1629701_at:571:63; Interrogation_Position=1235; Antisense; ATGGGAAAATCAGCCGGCCACTGCT
>probe:Drosophila_2:1629701_at:321:35; Interrogation_Position=1261; Antisense; ATCACCCACTGCGAATTGCTGTAGG
>probe:Drosophila_2:1629701_at:215:529; Interrogation_Position=1296; Antisense; GGGTACTTCTGGTTTCATAACGCAG
>probe:Drosophila_2:1629701_at:436:563; Interrogation_Position=1338; Antisense; GGAATGATTCTCTGCGGGCTGGAAC
>probe:Drosophila_2:1629701_at:136:373; Interrogation_Position=1365; Antisense; GAAGTCCTGCAAATGTTCTTTTACG
>probe:Drosophila_2:1629701_at:20:693; Interrogation_Position=1384; Antisense; TTTACGGATTTTAACCAGGGCGCAT
>probe:Drosophila_2:1629701_at:588:649; Interrogation_Position=900; Antisense; TCAGAGGTCGCATGAGTTCGCCGTA
>probe:Drosophila_2:1629701_at:501:365; Interrogation_Position=929; Antisense; GAATCTTTCCACGTCTGTGGGTGGA
>probe:Drosophila_2:1629701_at:657:69; Interrogation_Position=987; Antisense; AGGCGAAGCATCCTCTTTAAGCTAT

Paste this into a BLAST search page for me
TAAGCTATCGTGATCCCATGGAGTTGAGAGTGGTGAGTCACGCCCGCTACAGGAGTACTGTGTCCACGGATTTCCGGCGGAGCCATTAACTTTAGCATCATTAGCATCAGTTTCAAGCCTCTGCCATGGGAAAATCAGCCGGCCACTGCTATCACCCACTGCGAATTGCTGTAGGGGGTACTTCTGGTTTCATAACGCAGGGAATGATTCTCTGCGGGCTGGAACGAAGTCCTGCAAATGTTCTTTTACGTTTACGGATTTTAACCAGGGCGCATTCAGAGGTCGCATGAGTTCGCCGTAGAATCTTTCCACGTCTGTGGGTGGAAGGCGAAGCATCCTCTTTAAGCTAT

Full Affymetrix probeset data:

Annotations for 1629701_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720