FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629703_at:

>probe:Drosophila_2:1629703_at:218:663; Interrogation_Position=13; Antisense; TACAGTCCGACGAACAATTGCATTG
>probe:Drosophila_2:1629703_at:309:303; Interrogation_Position=172; Antisense; CCAGACCTCCGCGAAAGAACGATGT
>probe:Drosophila_2:1629703_at:471:443; Interrogation_Position=192; Antisense; GATGTCAACACTATGGCTGATGCCT
>probe:Drosophila_2:1629703_at:152:607; Interrogation_Position=209; Antisense; TGATGCCTACAAGTTCCTGCAGGAT
>probe:Drosophila_2:1629703_at:230:73; Interrogation_Position=229; Antisense; AGGATCTGGACACCTACTACGGCGA
>probe:Drosophila_2:1629703_at:727:399; Interrogation_Position=252; Antisense; GACAGAGCCCGCGTTCGGTTCGGAA
>probe:Drosophila_2:1629703_at:341:715; Interrogation_Position=265; Antisense; TTCGGTTCGGAAAGCGCGGATCGCT
>probe:Drosophila_2:1629703_at:453:299; Interrogation_Position=279; Antisense; CGCGGATCGCTGATGGATATCCTGA
>probe:Drosophila_2:1629703_at:275:247; Interrogation_Position=28; Antisense; AATTGCATTGTGACACCGTTGCGCT
>probe:Drosophila_2:1629703_at:427:73; Interrogation_Position=353; Antisense; AGGAGAATTTGCTCGCGGTTTTAAT
>probe:Drosophila_2:1629703_at:103:567; Interrogation_Position=415; Antisense; GGCAACGTCACTAACTCATGATGAT
>probe:Drosophila_2:1629703_at:507:469; Interrogation_Position=45; Antisense; GTTGCGCTTTCCAATACTCAAACTC
>probe:Drosophila_2:1629703_at:440:467; Interrogation_Position=73; Antisense; GTTGAACCAGAACTATGTGCCAAAC
>probe:Drosophila_2:1629703_at:116:187; Interrogation_Position=95; Antisense; AACAATGCGTTGCATCCTGGTTGCC

Paste this into a BLAST search page for me
TACAGTCCGACGAACAATTGCATTGCCAGACCTCCGCGAAAGAACGATGTGATGTCAACACTATGGCTGATGCCTTGATGCCTACAAGTTCCTGCAGGATAGGATCTGGACACCTACTACGGCGAGACAGAGCCCGCGTTCGGTTCGGAATTCGGTTCGGAAAGCGCGGATCGCTCGCGGATCGCTGATGGATATCCTGAAATTGCATTGTGACACCGTTGCGCTAGGAGAATTTGCTCGCGGTTTTAATGGCAACGTCACTAACTCATGATGATGTTGCGCTTTCCAATACTCAAACTCGTTGAACCAGAACTATGTGCCAAACAACAATGCGTTGCATCCTGGTTGCC

Full Affymetrix probeset data:

Annotations for 1629703_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720