Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629705_at:

>probe:Drosophila_2:1629705_at:307:471; Interrogation_Position=1040; Antisense; GTTCCCCTACTCAAGGATGCTGGTA
>probe:Drosophila_2:1629705_at:150:661; Interrogation_Position=1047; Antisense; TACTCAAGGATGCTGGTACCCATAA
>probe:Drosophila_2:1629705_at:95:225; Interrogation_Position=1052; Antisense; AAGGATGCTGGTACCCATAAGTACT
>probe:Drosophila_2:1629705_at:288:671; Interrogation_Position=1063; Antisense; TACCCATAAGTACTATCCGTTCCAT
>probe:Drosophila_2:1629705_at:53:219; Interrogation_Position=1070; Antisense; AAGTACTATCCGTTCCATGACGAGT
>probe:Drosophila_2:1629705_at:500:489; Interrogation_Position=1072; Antisense; GTACTATCCGTTCCATGACGAGTAT
>probe:Drosophila_2:1629705_at:48:471; Interrogation_Position=1081; Antisense; GTTCCATGACGAGTATTAGGCCTTA
>probe:Drosophila_2:1629705_at:137:611; Interrogation_Position=1087; Antisense; TGACGAGTATTAGGCCTTAAGAAAC
>probe:Drosophila_2:1629705_at:201:689; Interrogation_Position=1096; Antisense; TTAGGCCTTAAGAAACTTATATCTG
>probe:Drosophila_2:1629705_at:564:389; Interrogation_Position=1107; Antisense; GAAACTTATATCTGAAGAGCAAGAA
>probe:Drosophila_2:1629705_at:566:685; Interrogation_Position=1153; Antisense; TATACCTATTGGAAAGGGAAACGCT
>probe:Drosophila_2:1629705_at:394:143; Interrogation_Position=1202; Antisense; ACTGGTCTATATAAACATGAACATG
>probe:Drosophila_2:1629705_at:69:383; Interrogation_Position=1220; Antisense; GAACATGAGTTCAACCCAATACGGT
>probe:Drosophila_2:1629705_at:131:601; Interrogation_Position=1225; Antisense; TGAGTTCAACCCAATACGGTCACCC

Paste this into a BLAST search page for me
GTTCCCCTACTCAAGGATGCTGGTATACTCAAGGATGCTGGTACCCATAAAAGGATGCTGGTACCCATAAGTACTTACCCATAAGTACTATCCGTTCCATAAGTACTATCCGTTCCATGACGAGTGTACTATCCGTTCCATGACGAGTATGTTCCATGACGAGTATTAGGCCTTATGACGAGTATTAGGCCTTAAGAAACTTAGGCCTTAAGAAACTTATATCTGGAAACTTATATCTGAAGAGCAAGAATATACCTATTGGAAAGGGAAACGCTACTGGTCTATATAAACATGAACATGGAACATGAGTTCAACCCAATACGGTTGAGTTCAACCCAATACGGTCACCC

Full Affymetrix probeset data:

Annotations for 1629705_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime