FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629706_at:

>probe:Drosophila_2:1629706_at:649:283; Interrogation_Position=135; Antisense; CTGTTGTGGCAAATCCTTTCTGGAT
>probe:Drosophila_2:1629706_at:636:31; Interrogation_Position=158; Antisense; ATAAGTTCCCCTTTGTTGGCAGCAA
>probe:Drosophila_2:1629706_at:639:349; Interrogation_Position=176; Antisense; GCAGCAATTGCACACCGTTTTGGGA
>probe:Drosophila_2:1629706_at:432:505; Interrogation_Position=209; Antisense; GTCCTTGCCGCTATGAATGTCTGTA
>probe:Drosophila_2:1629706_at:667:141; Interrogation_Position=239; Antisense; ACTGGGACCTCCTTGATCAGGATAA
>probe:Drosophila_2:1629706_at:726:179; Interrogation_Position=273; Antisense; AAAACCGGAGCTCTACCTGATGATC
>probe:Drosophila_2:1629706_at:666:521; Interrogation_Position=338; Antisense; GGGCCGCTTTTAAGGCAGCTCACGA
>probe:Drosophila_2:1629706_at:636:137; Interrogation_Position=359; Antisense; ACGAGACTTGCGAAGCTCTGGGCTC
>probe:Drosophila_2:1629706_at:597:31; Interrogation_Position=428; Antisense; ATAAGATGGGCATGGCTTCCTCAAC
>probe:Drosophila_2:1629706_at:445:599; Interrogation_Position=454; Antisense; TGTCTGCCATATGCCATGCTTCATG
>probe:Drosophila_2:1629706_at:269:487; Interrogation_Position=485; Antisense; GTACCATGGTATACCTAACCGCCAA
>probe:Drosophila_2:1629706_at:75:255; Interrogation_Position=507; Antisense; CAACTGTCCCCGTGAGAACTGGATA
>probe:Drosophila_2:1629706_at:726:371; Interrogation_Position=661; Antisense; GAAGGATCCAATCTGCTCATGGCCT
>probe:Drosophila_2:1629706_at:535:477; Interrogation_Position=686; Antisense; GTTTTCTCACACTGATGATCGCCAA

Paste this into a BLAST search page for me
CTGTTGTGGCAAATCCTTTCTGGATATAAGTTCCCCTTTGTTGGCAGCAAGCAGCAATTGCACACCGTTTTGGGAGTCCTTGCCGCTATGAATGTCTGTAACTGGGACCTCCTTGATCAGGATAAAAAACCGGAGCTCTACCTGATGATCGGGCCGCTTTTAAGGCAGCTCACGAACGAGACTTGCGAAGCTCTGGGCTCATAAGATGGGCATGGCTTCCTCAACTGTCTGCCATATGCCATGCTTCATGGTACCATGGTATACCTAACCGCCAACAACTGTCCCCGTGAGAACTGGATAGAAGGATCCAATCTGCTCATGGCCTGTTTTCTCACACTGATGATCGCCAA

Full Affymetrix probeset data:

Annotations for 1629706_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720