FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629708_at:

>probe:Drosophila_2:1629708_at:46:607; Interrogation_Position=2232; Antisense; TGATGAACCGGCAGGACATTCCAAA
>probe:Drosophila_2:1629708_at:33:363; Interrogation_Position=2276; Antisense; GCAATAACACTTGGGCGCCTCGGAA
>probe:Drosophila_2:1629708_at:419:323; Interrogation_Position=2290; Antisense; GCGCCTCGGAAATGCATGTCCAGAT
>probe:Drosophila_2:1629708_at:541:597; Interrogation_Position=2306; Antisense; TGTCCAGATGAAGTGGCTCCCTATT
>probe:Drosophila_2:1629708_at:596:687; Interrogation_Position=2327; Antisense; TATTTGCCCGAATTCCTACGCCAGT
>probe:Drosophila_2:1629708_at:462:279; Interrogation_Position=2342; Antisense; CTACGCCAGTGGTGCTTGTTATTGC
>probe:Drosophila_2:1629708_at:562:721; Interrogation_Position=2363; Antisense; TTGCGTTACGCATATGACCACGACG
>probe:Drosophila_2:1629708_at:170:235; Interrogation_Position=2432; Antisense; AATCCAGGAGGCGTGGTGCCCGACT
>probe:Drosophila_2:1629708_at:425:403; Interrogation_Position=2453; Antisense; GACTTCTTATTCTTTTGCGATGCCA
>probe:Drosophila_2:1629708_at:667:447; Interrogation_Position=2471; Antisense; GATGCCATTGCCTCGTGGGACAATC
>probe:Drosophila_2:1629708_at:635:47; Interrogation_Position=2493; Antisense; ATCCTCCACAGGATCTGCGTCAGAT
>probe:Drosophila_2:1629708_at:366:525; Interrogation_Position=2582; Antisense; GGGAAATTTCCACAACCACTGGCCT
>probe:Drosophila_2:1629708_at:207:581; Interrogation_Position=2601; Antisense; TGGCCTGCCGGCTAATCGAACTGTA
>probe:Drosophila_2:1629708_at:196:29; Interrogation_Position=2635; Antisense; ATACTAATCCGAAGCTATCCAGCCA

Paste this into a BLAST search page for me
TGATGAACCGGCAGGACATTCCAAAGCAATAACACTTGGGCGCCTCGGAAGCGCCTCGGAAATGCATGTCCAGATTGTCCAGATGAAGTGGCTCCCTATTTATTTGCCCGAATTCCTACGCCAGTCTACGCCAGTGGTGCTTGTTATTGCTTGCGTTACGCATATGACCACGACGAATCCAGGAGGCGTGGTGCCCGACTGACTTCTTATTCTTTTGCGATGCCAGATGCCATTGCCTCGTGGGACAATCATCCTCCACAGGATCTGCGTCAGATGGGAAATTTCCACAACCACTGGCCTTGGCCTGCCGGCTAATCGAACTGTAATACTAATCCGAAGCTATCCAGCCA

Full Affymetrix probeset data:

Annotations for 1629708_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720