Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629709_at:

>probe:Drosophila_2:1629709_at:730:389; Interrogation_Position=1360; Antisense; GAAACATCAGCGAACCCATTCGGGT
>probe:Drosophila_2:1629709_at:530:229; Interrogation_Position=1398; Antisense; AATGTGAGGAGTGCGGCCAAGCCTT
>probe:Drosophila_2:1629709_at:713:255; Interrogation_Position=1427; Antisense; CACAACCATCACCTTAAGAGTCATC
>probe:Drosophila_2:1629709_at:148:213; Interrogation_Position=1442; Antisense; AAGAGTCATCTACGCATCCATACAG
>probe:Drosophila_2:1629709_at:356:251; Interrogation_Position=1498; Antisense; CAAGGGTTTCAGTGCGAATCAGTCA
>probe:Drosophila_2:1629709_at:8:615; Interrogation_Position=1527; Antisense; TGAAGCATACCCTTTGGCACGTGGA
>probe:Drosophila_2:1629709_at:677:165; Interrogation_Position=1571; Antisense; AAATGTTCTCAGTGTCCCAAAGCCT
>probe:Drosophila_2:1629709_at:252:127; Interrogation_Position=1591; Antisense; AGCCTATGACACTCAGCAGAGCTTA
>probe:Drosophila_2:1629709_at:195:375; Interrogation_Position=1627; Antisense; GAAGACGCACAAAAACCCGGATGAG
>probe:Drosophila_2:1629709_at:325:259; Interrogation_Position=1676; Antisense; CACTGCGACGTCAGGTTTGCTTTAA
>probe:Drosophila_2:1629709_at:469:505; Interrogation_Position=1761; Antisense; GTCCAGAGGGATTTTTCTCCCAGAA
>probe:Drosophila_2:1629709_at:254:173; Interrogation_Position=1795; Antisense; AAAGCACTTGCGACTTCACAACCTA
>probe:Drosophila_2:1629709_at:470:31; Interrogation_Position=1830; Antisense; ATAAGATTATCCTGTAGCCCCAGCA
>probe:Drosophila_2:1629709_at:434:487; Interrogation_Position=1843; Antisense; GTAGCCCCAGCATAAGACCATTAGT

Paste this into a BLAST search page for me
GAAACATCAGCGAACCCATTCGGGTAATGTGAGGAGTGCGGCCAAGCCTTCACAACCATCACCTTAAGAGTCATCAAGAGTCATCTACGCATCCATACAGCAAGGGTTTCAGTGCGAATCAGTCATGAAGCATACCCTTTGGCACGTGGAAAATGTTCTCAGTGTCCCAAAGCCTAGCCTATGACACTCAGCAGAGCTTAGAAGACGCACAAAAACCCGGATGAGCACTGCGACGTCAGGTTTGCTTTAAGTCCAGAGGGATTTTTCTCCCAGAAAAAGCACTTGCGACTTCACAACCTAATAAGATTATCCTGTAGCCCCAGCAGTAGCCCCAGCATAAGACCATTAGT

Full Affymetrix probeset data:

Annotations for 1629709_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime