FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629710_at:

>probe:Drosophila_2:1629710_at:502:213; Interrogation_Position=1062; Antisense; AAGAGCGGTCGCTTTGCTCCTTATA
>probe:Drosophila_2:1629710_at:415:337; Interrogation_Position=1077; Antisense; GCTCCTTATAGCTACAGTTCCAATA
>probe:Drosophila_2:1629710_at:308:201; Interrogation_Position=1143; Antisense; AACCTGAGTCTGGTGACGGTGCCCA
>probe:Drosophila_2:1629710_at:454:489; Interrogation_Position=1175; Antisense; GTACTACTCTACCAATGATCTGCTT
>probe:Drosophila_2:1629710_at:530:87; Interrogation_Position=1219; Antisense; AGTCCATGTGCGATGACCTGGGCAA
>probe:Drosophila_2:1629710_at:519:55; Interrogation_Position=1231; Antisense; ATGACCTGGGCAACGTGACGGGCAA
>probe:Drosophila_2:1629710_at:484:361; Interrogation_Position=1252; Antisense; GCAAGTACCTGGTGCCGCAGAAGGA
>probe:Drosophila_2:1629710_at:116:551; Interrogation_Position=1274; Antisense; GGAGTTCAACCACATGGACTTCCTC
>probe:Drosophila_2:1629710_at:86:307; Interrogation_Position=1295; Antisense; CCTCTGGGCCATCGATGTGCGAAAA
>probe:Drosophila_2:1629710_at:281:181; Interrogation_Position=1316; Antisense; AAAAATGCTCTATCGCCGTATGCTG
>probe:Drosophila_2:1629710_at:234:485; Interrogation_Position=1333; Antisense; GTATGCTGCAGGTCCTCGGAAAAGT
>probe:Drosophila_2:1629710_at:19:185; Interrogation_Position=1352; Antisense; AAAAGTGCCAGAGGGCTCGCCAGAA
>probe:Drosophila_2:1629710_at:137:249; Interrogation_Position=1426; Antisense; AATTGTGTTACCTCTTCTTGGACAT
>probe:Drosophila_2:1629710_at:449:193; Interrogation_Position=1501; Antisense; AACTCTGTGCTTCGTATTTATTACC

Paste this into a BLAST search page for me
AAGAGCGGTCGCTTTGCTCCTTATAGCTCCTTATAGCTACAGTTCCAATAAACCTGAGTCTGGTGACGGTGCCCAGTACTACTCTACCAATGATCTGCTTAGTCCATGTGCGATGACCTGGGCAAATGACCTGGGCAACGTGACGGGCAAGCAAGTACCTGGTGCCGCAGAAGGAGGAGTTCAACCACATGGACTTCCTCCCTCTGGGCCATCGATGTGCGAAAAAAAAATGCTCTATCGCCGTATGCTGGTATGCTGCAGGTCCTCGGAAAAGTAAAAGTGCCAGAGGGCTCGCCAGAAAATTGTGTTACCTCTTCTTGGACATAACTCTGTGCTTCGTATTTATTACC

Full Affymetrix probeset data:

Annotations for 1629710_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720